Awat2 (NM_001290395) Mouse Untagged Clone

CAT#: MC226766

Awat2 (untagged) - Mouse acyl-CoA wax alcohol acyltransferase 2 (Awat2), transcript variant 2



  "NM_001290395" in other vectors (1)

CNY 2,760.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9430062J17Rik; ARAT; Dgat2l4; WS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226766 representing NM_001290395
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCACCTGGCTGGCTTTTGACTGGAAGACCCCTGAGCGAGGTGGCCGCAGGTTCACCTGTGTGAGGA
AGTGGCGTCTGTGGAAACACTATAGCGACTACTTCCCACTCAAGATGGTGAAGACGAAAGATATTTCACC
TGACCGCAACTACATCCTTGTCTGCCATCCTCATGGGCTCATGGCCCATTCATGTTTTGGTCACTTTGCC
ACTGACACAACAGGCTTTTCCAAGACCTTTCCTGGTATCACTCCTTATATGCTCACACTAGGAGCCTTTT
TCTGGGTACCTTTCCTCAGAGATTATGTAATGTCTACAGGGTCGTGCTCTGTGAGTAGATCCTCCATGGA
CTTTTTGCTTACCCAGAAGGGCACAGGCAACATGCTTGTGGTGGTGGTTGGTGGCCTGGCTGAGTGCAGA
TACAGCACGCCAGGCTCTACCACCCTGTTCTTGAAGAAGCGGCAAGGCTTTGTGCGCACAGCCCTTAAAC
ATGGGGTGTCTCTAATCCCAGCTTATGCCTTTGGAGAGACAGACCTCTATGACCAGCACATTTTCACTCC
TGGGGGCTTTGTCAATCGCTTCCAGAAGTGGTTCCAGAAGATGGTACACATCTACCCCTGTGCTTTCTAT
GGGCGTGGCCTCACCAAGAACTCCTGGGGCCTTCTGCCCTATTCTCAGCCAGTAACCACTGTTGTTGGAG
AACCTCTACCATTGCCCAAGATTGAGAATCCGAGCGAGGAGATTGTGGCCAAATACCACACACTCTATAT
TGATGCCCTACGAAAATTGTTTGATCAGCATAAGACCAAGTTTGGCATCTCAGAGACCCAGGAGCTGGTG
ATAGTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290395
Insert Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290395.1, NP_001277324.1
RefSeq Size 2002 bp
RefSeq ORF 849 bp
Locus ID 245532
UniProt ID Q6E1M8
Gene Summary Acyltransferase that predominantly esterify long chain (wax) alcohols with acyl-CoA-derived fatty acids to produce wax esters. Wax esters are enriched in sebum, suggesting that it plays a central role in lipid metabolism in skin. Has no activity using decyl alcohol and significantly prefers the C16 and C18 alcohols. May also have 2-acylglycerol O-acyltransferase (MGAT) and acyl-CoA:retinol acyltransferase (ARAT) activities, to catalyze the synthesis of diacylglycerols and retinyl esters; however this activity is unclear in vivo (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...