Dmc1 (NM_001278226) Mouse Untagged Clone

CAT#: MC226792

Dmc1 (untagged) - Mouse DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (Dmc1), transcript variant 2



  "NM_001278226" in other vectors (1)

CNY 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Dmc1h; Lim15; Mei1; Mei11; sg; sgdp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226792 representing NM_001278226
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGAGGATCAAGTTGTGCAGGAAGAATCGGGATTCCAAGATGATGAGGAATCTCTGTTTCAAGACA
TTGACCTGTTGCAGAAGCATGGGATTAACATGGCTGATATTAAGAAACTGAAGTCTGTAGGAATCTGTAC
CATTAAAGGGATACAAATGACAACAAGAAGAGCCCTCTGCAATGTCAAAGGCCTCTCAGAAGCCAAAGTG
GAAAAGATTAAAGAGGCAGCCAACAAGCTTATTGAACCAGGATTCCTAACTGCATTTCAGTACAGTGAAA
GGAGGAAGATGGTATTCCATATCACTACTGGGAGCCAGGAATTTGATAAATTACTAGGAGGTGGCATTGA
AAGTATGGCAATTACAGAAGCTTTTGGAGAATTTCGTACTGGAAAAACTCAGCTGTCTCATACCCTCTGT
GGTGAGCATCAGATGGAGCTACTTGATTATGTCGCAGCCAAGTTTCATGAGGAAGCTGGCATTTTCAAAC
TATTGATCATTGACTCAATAATGGCACTTTTTCGAGTGGATTTCAGTGGCCGTGGGGAATTGGCTGAACG
CCAGCAAAAATTGGCCCAGATGTTGTCACGACTCCAAAAAATCTCAGAAGAATATAATGTTGCTGTTTTT
GTGACCAATCAAATGACTGCAGATCCAGGAGCAACTATGACCTTTCAGGCTGATCCCAAAAAACCCATTG
GTGGACACATTCTGGCTCACGCTTCCACAACAAGAATAAGCTTGCGCAAGGGAAGAGGAGAACTGAGGAT
CGCCAAGATTTATGACAGCCCCGAGATGCCTGAAAATGAAGCCACCTTCGCAATAACCGCTGGAGGGATC
GGGGATGCCAAGGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001278226
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278226.1, NP_001265155.1
RefSeq Size 2062 bp
RefSeq ORF 858 bp
Locus ID 13404
Gene Summary This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. In mouse, deficiency of this gene causes infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) lacks two alternate exons in the coding region compared to variant 1. The resulting protein (isoform 2) lacks an internal portion and is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...