Nr1i3 (NM_001243062) Mouse Untagged Clone

CAT#: MC226799

Nr1i3 (untagged) - Mouse nuclear receptor subfamily 1, group I, member 3 (Nr1i3), transcript variant 2



  "NM_001243062" in other vectors (1)

CNY 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-NR1I3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA209988; AI551208; CAR; CAR-beta; Care2; ESTM32; MB67
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226799 representing NM_001243062
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAGCTATGCTAACACTAGAAACCATGGCCAGTGAAGAAGAATATGGGCCGAGGAACTGTGTGGTGT
GTGGAGACCGGGCCACAGGCTATCATTTCCACGCCCTGACTTGTGAGGGCTGCAAGGGCTTCTTCAGACG
AACAGTCAGCAAAACCATTGGTCCCATCTGTCCGTTTGCTGGAAGGTGTGAGGTCAGCAAGGCCCAGAGA
CGCCACTGTCCAGCCTGCAGGTTGCAGAAGTGTCTAAATGTTGGCATGAGGAAAGACATGATACTGTCAG
CAGAAGCCCTGGCATTGCGGCGAGCCAGACAGGCACAGCGGCGGGCAGAGAAAGCATCTTTGCAACTGAA
TCAGCAGCAGAAAGAACTGGTCCAGATCCTCCTGGGGGCCCACACTCGCCATGTGGGCCCCATGTTTGAC
CAGTTTGTGCAGTTCAAGCCTCCGGCCTATCTGTTCATGCATCACCGGCCTTTCCAGCCTCGGGGCCCCG
TGTTGCCTCTGCTCACACACTTTGCAGATATCAACACGTTTATGGTGCAACAGATCATCAAGTTCACCAA
GGATCTGCCGCTCTTCCGGTCCCTAACCATGGAGGACCAGATCTCCCTTCTCAAGGGAGCGGCTGTGGAA
ATATTGCATATCTCACTCAACACTACGTTCTGTCTTCAAACAGAGAATTTCTTCTGTGGGCCTCTTTGCT
ACAAGATGGAGGACGCAGTCCATGCAGGGTTCCAGTACGAGTTTTTGGAGTCGATCCTCCACTTCCATAA
AAACCTGAAAGGACTGCATCTCCAGGAGCCTGAGTATGTGCTCATGGCTGCCACGGCCCTCTTCTCCCCT
GGTTTCTGTATGCAAAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001243062
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243062.1, NP_001229991.1
RefSeq Size 1322 bp
RefSeq ORF 861 bp
Locus ID 12355
UniProt ID O35627
Gene Summary Binds and transactivates the retinoic acid response elements that control expression of the retinoic acid receptor beta 2 and alcohol dehydrogenase 3 genes. Transactivates both the phenobarbital responsive element module of the human CYP2B6 gene and the CYP3A4 xenobiotic response element (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region which results in a frameshift, compared to variant 1. This results in a shorter and distinct C-terminus in isoform 2, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...