Cyb5r2 (NM_001205227) Mouse Untagged Clone

CAT#: MC226844

Cyb5r2 (untagged) - Mouse cytochrome b5 reductase 2 (Cyb5r2), transcript variant 1



  "NM_001205227" in other vectors (1)

CNY 2,850.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms b5R.2; D630003K02Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226844 representing NM_001205227
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGTCAAGAAGAAAGATCTTATCACCTTACAGGACCCTGAAGCCAAGTACCCGCTGCCCTTGATTG
AGAAGGAGCAAATCAGTCACAACACCAGAAGGTTCCGCTTTGGGCTGCCCTCACCAGACCATGTCCTGGG
GCTTCCTGTCGGTAACTATGTCCATCTCTTGGCACAAATTAACAATGAATTGGTGATCAGGGCTTACACA
CCTGTCTCCAGTGACGATGATCAAGGCTTTGTGGACTTAATTATAAAGATCTACTTCAAAAATGTGCACC
CCAAGTATCCTGAAGGAGGAAAGATGACTCAGTACTTGGAGAACATGAAAATTGGGGATACCATCCTTTT
TCGGGGGCCAACAGGGCGCCTGTTCTACAATGAGCCAGGCTGCCAGACAAGGGCTGCAGAAGTCAAAAAC
ATCTTTATATTTCTAGGAACCCTTTTAATCAAAGCAAACAAAACAAGTGAGCCTGAAAAAAAGCTGGTTC
ACCACCTGGGGATGATTGCTGGAGGCACAGGCATTACGCCCATGCTACAGCTGATTCGCCACATCACCAA
GGACACCAGCGATGAGACCAGGATGTCCCTCCTCTTTGCTAACCAGACAGAAGAGGATATCTTGCTGAGA
AAGGAGCTAGAAGAAGTCGCCACGACTCATCACAAACAGTTCAACCTGTGGTATACCCTGGACAGGCCTC
CCAGTGACTGGAAGTACAGCTCAGGCTTTGTTAGCGCTGACATGATCAAGGAGCACCTCCCTCCTCCTGG
GGAGGACACGCTCATCCTGGTGTGTGGCCCACCACCTCTGATCCAGGCGGCAGCTCACCCCAGCCTGGAG
CAGCTCAGCTATACCAAGGACATGATTTTTATCTACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001205227
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001205227.1, NP_001192156.1
RefSeq Size 2772 bp
RefSeq ORF 879 bp
Locus ID 320635
UniProt ID Q3KNK3
Gene Summary NADH-cytochrome b5 reductases are involved in desaturation and elongation of fatty acids, cholesterol biosynthesis, drug metabolism, and, in erythrocyte, methemoglobin reduction. Responsible for NADH-dependent lucigenin chemiluminescence in spermatozoa by reducing both lucigenin and 2-[4-iodophenyl]-3-[4-nitrophenyl]-5-[2,4-disulfophenyl]-2H tetrazolium monosodium salt (WST-1) (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...