Sirpa (NM_001291021) Mouse Untagged Clone

CAT#: MC226866

Sirpa (untagged) - Mouse signal-regulatory protein alpha (Sirpa), transcript variant 6



  "NM_001291021" in other vectors (1)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI835480; Bit; CD172a; P84; Ptpns1; SHP-1; SHPS-1; SIRP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226866 representing NM_001291021
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCCGCCGGCCCGGCCCCTGGCCGCCTAGGGCCGCTGCTGCTCTGCCTGCTGCTCTCCGCGTCCT
GTTTCTGTACAGGAGCCACGGGGAAGGAACTGAAGGTGACTCAGCCTGAGAAATCAGTGTCTGTTGCTGC
TGGGGATTCGACCGTTCTGAACTGCACTTTGACCTCCTTGTTGCCGGTGGGACCCATTAGGTGGTACAGA
GGAGTAGGGCCAAGCCGGCTGTTGATCTACAGTTTCGCAGGAGAATACGTTCCTCGAATTAGAAATGTTT
CAGATACTACTAAGAGAAACAATATGGACTTTTCCATCCGTATCAGTAATGTCACCCCAGCAGATGCTGG
CATCTACTACTGTGTGAAGTTCCAGAAAGGATCATCAGAGCCTGACACAGAAATACAATCTGGAGGGGGA
ACAGAGGTCTATGTACTCGATAATAATGCTACCCACAACTGGAATGTCTTCATCGGTGTGGGCGTGGCGT
GTGCTTTGCTCGTAGTCCTGCTGATGGCTGCTCTCTACCTCCTCCGGATCAAACAGAAGAAAGCCAAGGG
GTCAACATCTTCCACACGGTTGCACGAGCCCGAGAAGAACGCCAGGGAAATAACCCAGGTACAGTCTTTG
ATCCAGGACACAAATGACATCAACGACATCACATACGCAGACCTGAATCTGCCCAAAGAGAAGAAGCCCG
CACCCCGGGCCCCTGAGCCTAACAACCACACAGAATATGCAAGCATTGAGACAGGCAAAGTGCCTAGGCC
AGAGGATACCCTCACCTATGCTGACCTGGACATGGTCCACCTCAGCCGGGCACAGCCAGCCCCCAAGCCT
GAGCCATCTTTCTCAGAGTATGCTAGTGTCCAGGTCCAGAGGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291021
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291021.1, NP_001277950.1
RefSeq Size 3389 bp
RefSeq ORF 888 bp
Locus ID 19261
UniProt ID P97797
Gene Summary Immunoglobulin-like cell surface receptor for CD47. Acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. Supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. May play a key role in intracellular signaling during synaptogenesis and in synaptic function. Involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. Mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation. CD47 binding prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) lacks two alternate in-frame exons in the central coding region, compared to variant 4, resulting in an isoform (4) that is shorter than isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...