Capzb (NM_001271405) Mouse Untagged Clone

CAT#: MC226895

Capzb (untagged) - Mouse capping protein (actin filament) muscle Z-line, beta (Capzb), transcript variant 3



  "NM_001271405" in other vectors (1)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700120C01Rik; AI325129; Cap; Cappb1; CPB; CPB1; CPB2; CPbeat2; CPbet; CPbeta1; CPbeta2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226895 representing NM_001271405
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATCCTAGCAGGCGCAGCCTTCCTTTCCCCCTGAACTGTCAGCTTGTTAGAGTTGGGACTGCTGATT
ATGGAGGTGCCTCGGAGCAGAGCGATCAGCAGCTGGACTGCGCCTTGGACCTGATGAGGCGCCTGCCTCC
ACAGCAGATTGAGAAGAACCTCAGCGATCTGATCGACCTGGTCCCCAGTCTGTGTGAAGATCTCCTGTCA
TCTGTTGACCAGCCCCTGAAAATTGCCAGAGACAAGGTGGTGGGCAAGGATTACCTTTTGTGTGACTACA
ACAGAGACGGGGACTCCTATAGGTCACCGTGGAGTAACAAGTATGACCCTCCTTTGGAAGATGGGGCCAT
GCCATCTGCTCGGCTCAGAAAGCTGGAGGTAGAGGCCAACAATGCCTTCGACCAATACCGAGACCTGTAT
TTTGAAGGTGGGGTCTCATCAGTCTACCTCTGGGATCTTGATCATGGCTTTGCTGGAGTGATCCTCATAA
AGAAAGCTGGAGATGGATCCAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTGGAAGTGCAGGA
GAAGTCCAGCGGCCGTACTGCCCATTACAAGTTGACCTCCACGGTGATGCTATGGCTGCAAACCAACAAA
TCCGGCTCGGGCACCATGAACCTGGGAGGCAGCCTAACCAGACAGATGGAGAAAGACGAAACTGTGAGTG
ACTGTTCCCCACACATAGCCAACATCGGGCGCCTGGTGGAGGACATGGAAAACAAAATCCGAAGCACGCT
GAATGAGATCTACTTTGGAAAAACAAAGGACATCGTCAACGGGCTGAGGTCTGTGCAGACGTTTGCAGAC
AAATCAAAGCAAGAAGCGCTTAAGAACGACCTGGTGGAGGCCTTGAAGAGAAAGCAGCAGTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271405
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271405.1, NP_001258334.1
RefSeq Size 1655 bp
RefSeq ORF 906 bp
Locus ID 12345
UniProt ID P47757
Gene Summary This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (3) uses an alternate 5'-terminal exon and has multiple differences in the coding region, one of which results in use of an alternate start codon. It encodes isoform (c), which is shorter than and has distinct N- and C-termini compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...