Amigo1 (NM_001287093) Mouse Untagged Clone

CAT#: MC226943

Amigo1 (untagged) - Mouse adhesion molecule with Ig like domain 1 (Amigo1), transcript variant 3



  "NM_001287093" in other vectors (1)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
AMIGO1 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms ali2; Amigo
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226943 representing NM_001287093
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAACCCCAGCGTGACCTGCGAGGCCTCTGGCTCCTGCTGCTCTCCGTGTTCCTGCTTCTCTTTGAGG
TAGCCAGGGCCGGCCGATCTGTGGTTAGTTGTCCCGCCAACTGCCTGTGCGCCAGCAACATCCTCAGCTG
CTCCAAGCAGCAGCTGCCCAATGTGCCCCAATCTTTGCCCAGCTACACAGCACTGCTGGACCTCAGCCAC
AACAACTTGAGCAGGCTGCGGGCCGAGTGGACCCCCACCCGGCTGACCAACCTGCACTCCCTGCTGCTGA
GCCACAACCACCTGAACTTCATCTCCTCCGAGGCCTTCGTCCCCGTACCCAACCTTAGGTACTTGGACCT
CTCCTCCAACCATCTTCACACGCTGGATGAGTTCCTGTTCAGCGACCTGCAGGCGCTGGAAGTGCTGTTG
CTCTACAATAACCACATTGTGGTGGTGGACCGGAATGCCTTTGAGGACATGGCCCAGCTGCAGAAACTCT
ACTTAAGCCAGAATCAGATCTCTCGCTTTCCTGTGGAACTGATCAAGGATGGGAACAAATTACCCAAACT
GATGCTCTTGGATCTGTCCTCCAACAAGCTGAAGAAGTTGCCCCTGACTGACCTGCAGAAATTGCCAGCC
TGGGTCAAGAATGGGCTATACCTGCATAACAACCCCTTGGAGTGCGACTGCAAGCTCTACCAGCTCTTTT
CGCACTGGCAGTACCGGCAGCTGAGCTCTGTGATGGACTTCCAGGAGGACCTGTACTGCATGCACTCCAA
GAAGCTGCACAACATCTTCAGCCTGGATTTCTTCAATTGCAGCGAGTACAAGGAAAGTGCCTGGGAGGCT
CACCTGGGAGACACCTTGACCATCAGGACTCTTCCCCCCACTGTGTACACCAGGCTGGCAAACCTCAGAG
CCCATGGGCTCTATAACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001287093
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287093.1, NP_001274022.1
RefSeq Size 1930 bp
RefSeq ORF 930 bp
Locus ID 229715
UniProt ID Q80ZD8
Gene Summary Promotes growth and fasciculation of neurites from cultured hippocampal neurons. May be involved in fasciculation as well as myelination of developing neural axons. May have a role in regeneration as well as neural plasticity in the adult nervous system. May mediate homophilic as well as heterophilic cell-cell interaction and contribute to signal transduction through its intracellular domain (By similarity). Assembled with KCNB1 modulates the gating characteristics of the delayed rectifier voltage-dependent potassium channel KCNB1 (PubMed:22056818).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and has a different 3' structure resulting in a frameshift compared to variant 1. The encoded protein (isoform b) has a distinct C-terminus and is shorter than isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...