Oprm1 (NM_001302794) Mouse Untagged Clone

CAT#: MC227072

Oprm1 (untagged) - Mouse opioid receptor, mu 1 (Oprm1), transcript variant MOR-1G



  "NM_001302794" in other vectors (1)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Oprm1 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms m; M-OR-1; MO; MOP-R; mor; MOR-1; MOR-1O; mu; muOR; O; Oprm
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227072 representing NM_001302794
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGAAGCTTTCTCTAAGTCTGCATTCCAAAAGCTCAGACAGAGAGATGGAAATCAAGAGGGGAAGA
GTTACCTCAGATATACCAAAATGAAGACTGCCACCAACATCTACATTTTCAACCTTGCTCTGGCAGATGC
CTTAGCCACTAGCACGCTGCCCTTTCAGAGTGTTAACTACCTGATGGGAACGTGGCCCTTTGGAAACATC
CTCTGCAAGATCGTGATCTCAATAGACTACTACAACATGTTCACCAGTATCTTCACCCTCTGCACCATGA
GTGTAGACCGCTACATTGCCGTCTGCCACCCGGTCAAGGCCCTGGATTTCCGTACCCCCCGAAATGCCAA
AATTGTCAATGTCTGCAACTGGATCCTCTCTTCTGCCATTGGTCTGCCCGTAATGTTCATGGCAACCACA
AAATACAGGCAGGGGTCCATAGATTGCACCCTCACGTTCTCTCATCCCACATGGTACTGGGAGAACCTGC
TCAAAATCTGTGTCTTCATCTTCGCCTTCATCATGCCGGTCCTCATCATCACTGTGTGTTATGGACTGAT
GATCTTACGACTCAAGAGTGTCCGCATGCTGTCGGGCTCCAAAGAAAAGGACAGGAACCTGCGCAGGATC
ACCCGGATGGTGCTGGTGGTCGTGGCTGTATTTATTGTCTGCTGGACCCCCATCCACATCTATGTCATCA
TCAAAGCACTGATCACGATTCCAGAAACCACTTTCCAGACTGTTTCCTGGCACTTCTGCATTGCCTTGGG
TTACACAAACAGCTGCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGA
GAGTTCTGCATCCCAACTTCCTCCACAATCGAACAGCAAAACTCTGCTCGAATCCGTCAAAACACTAGGG
AACACCCCTCCACGGCTAATACAGTGGATCGAACTAACCACCAGCTAGAAAATCTGGAAGCAGAAACTGC
TCCATTGCCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302794
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302794.1, NP_001289723.1
RefSeq Size 1739 bp
RefSeq ORF 993 bp
Locus ID 18390
UniProt ID P42866
Gene Summary This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
Transcript Variant: has an alternate exon in place of the 5'-most exon, lacks several 3' coding exons, and contains an alternate 3' coding exon compared to variant MOR-1U. The resulting isoform (MOR-1G) has shorter and distinct N- and C-termini compared to isoform MOR-1U. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...