Prkaca (NM_001277898) Mouse Untagged Clone

CAT#: MC227158

Prkaca (untagged) - Mouse protein kinase, cAMP dependent, catalytic, alpha (Prkaca), transcript variant 2



  "NM_001277898" in other vectors (1)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C; P; Pk; Pkaca; PKCD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227158 representing NM_001277898
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCCAGCTCCAACGATGTGAAAGAGTTCCTAGCCAAAGCCAAGGAAGATTTCCTGAAAAAATGGG
AGACCCCTTCTCAGAATACAGCCCAGTTGGATCAGTTTGATAGAATCAAGACCCTTGGCACCGGCTCCTT
TGGGCGAGTGATGCTGGTGAAGCACAAGGAGAGTGGGAACCACTACGCCATGAAGATCTTAGACAAGCAG
AAGGTGGTGAAGCTAAAGCAGATCGAGCACACTCTGAATGAGAAGCGCATCCTGCAGGCCGTCAACTTCC
CGTTCCTGGTCAAACTTGAATTCTCCTTCAAGGACAACTCAAACCTGTACATGGTCATGGAGTATGTAGC
TGGTGGCGAGATGTTCTCCCACCTACGGCGGATTGGAAGGTTCAGCGAGCCCCATGCCCGTTTCTACGCG
GCGCAGATCGTCCTGACCTTTGAGTATCTGCACTCCCTGGACCTCATCTACCGGGACCTGAAGCCCGAGA
ATCTTCTCATCGACCAGCAGGGCTATATTCAGGTGACAGACTTCGGTTTTGCCAAGCGTGTGAAAGGCCG
TACTTGGACCTTGTGTGGGACCCCTGAGTACTTGGCCCCCGAGATTATCCTGAGCAAAGGCTACAACAAG
GCTGTGGACTGGTGGGCTCTCGGAGTCCTCATCTACGAGATGGCTGCTGGTTACCCACCCTTCTTCGCTG
ACCAGCCTATCCAGATCTATGAGAAAATCGTCTCTGGGAAGGTGCGGTTCCCATCCCACTTCAGCTCTGA
CTTGAAGGACCTGCTGCGGAACCTTCTGCAGGTGGATCTCACCAAGCGCTTTGGGAACCTCAAGAACGGG
GTCAATGACATCAAGAACCACAAGTGGTTTGCCACGACTGACTGGATTGCCATCTATCAGAGAAAGGTGG
AAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGACACGAGTAACTTTGACGACTATGAGGAGGAAGA
GATCCGGGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTACTGAGTTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277898
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277898.1, NP_001264827.1
RefSeq Size 2257 bp
RefSeq ORF 1032 bp
Locus ID 18747
UniProt ID P05132
Gene Summary This gene encodes a member of the serine/threonine protein kinase family. The holoenzyme, protein kinase A (also known as cyclic-AMP dependent protein kinase), mediates cellular response to changes in cyclic-AMP levels. This gene encodes the alpha catalytic subunit of protein kinase A. Protein kinase A-mediated signaling is transduced via phosphorylation of target proteins, and is important for many cellular functions, including mammalian sperm maturation and motility. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (2, also known as Cs and Calpha2) contains an alternate 5'-most exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct and shorter N-terminus, compared to isoform 1. This variant is testis-specific and the encoded isoform does not contain the myristylation signal found in isoform 1 (PMID: 10841548 and PMID: 10982398). There are no publicly available full-length transcripts for this variant, but it is supported by publication data, including PMID: 10982398.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...