Kcnab2 (NM_001252655) Mouse Untagged Clone

CAT#: MC227234

Kcnab2 (untagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, beta member 2 (Kcnab2), transcript variant 3



  "NM_001252655" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Mouse Monoclonal anti-KCNA2B Antibody
    • 100 ug

CNY 5,830.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms F5; I2rf5; Kcnb3; kv-beta-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227234 representing NM_001252655
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTATCCGGAATCAACCACGGGGTCCCCAGCTCGACTCTCCCTGCGGCAGACAGGCTCCCCCGGGATGA
TCTACAGGAATCTGGGCAAATCTGGCCTTCGGGTCTCCTGCCTGGGGCTTGGAACATGGGTGACCTTCGG
GGGCCAGATCACGGATGAGATGGCAGAGCACCTAATGACCTTGGCCTACGATAATGGCATCAACCTGTTC
GATACGGCGGAGGTCTACGCTGCTGGAAAAGCTGAAGTGGTATTAGGGAACATCATTAAGAAGAAGGGAT
GGAGACGGTCCAGCCTTGTCATCACCACCAAGATCTTCTGGGGTGGAAAAGCGGAGACTGAGAGAGGCCT
TTCCAGGAAGCACATAATTGAAGGACTGAAAGCGTCCCTGGAGCGGCTGCAGCTGGAGTACGTGGATGTG
GTTTTTGCCAACCGCCCAGACCCCAACACGCCCATGGAAGAGACCGTGCGGGCCATGACCCATGTCATCA
ACCAGGGGATGGCCATGTACTGGGGCACATCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCGGT
GGCTCGGCAGTTCAACCTGATCCCGCCCATCTGCGAGCAAGCGGAATATCACATGTTCCAGAGGGAGAAG
GTGGAGGTCCAGCTGCCAGAGCTGTTCCACAAGATAGGAGTAGGTGCCATGACCTGGTCCCCTCTGGCGT
GCGGCATCGTCTCAGGGAAGTATGACAGCGGGATCCCACCCTACTCCAGAGCCTCCCTGAAGGGCTACCA
GTGGTTGAAGGACAAGATCCTGAGTGAGGAGGGTCGCCGCCAGCAGGCCAAGCTGAAGGAACTGCAGGCC
ATTGCCGAACGCCTGGGCTGCACCCTACCCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGTGTCA
GCTCCGTGCTTCTGGGTGCTTCCAATGCAGAACAACTTATGGAGAACATTGGAGCAATACAGGTCCTTCC
AAAATTGTCGTCTTCCATCGTCCACGAGATCGACAGCATTCTGGGCAATAAACCCTACAGCAAAAAGGAC
TATAGATCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252655
Insert Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252655.1, NP_001239584.1
RefSeq Size 3591 bp
RefSeq ORF 1062 bp
Locus ID 16498
Gene Summary Cytoplasmic potassium channel subunit that modulates the characteristics of the channel-forming alpha-subunits (PubMed:8576199). Contributes to the regulation of nerve signaling, and prevents neuronal hyperexcitability (PubMed:11825900, PubMed:21209188). Promotes expression of the pore-forming alpha subunits at the cell membrane, and thereby increases channel activity (By similarity). Promotes potassium channel closure via a mechanism that does not involve physical obstruction of the channel pore (PubMed:8576199). Modulates the functional properties of KCNA4 (By similarity). Modulates the functional properties of KCNA5 (PubMed:8576199). Enhances KCNB2 channel activity (PubMed:8824288). Modulates the functional properties of KCNA5 (PubMed:8576199). Binds NADPH and has NADPH-dependent aldoketoreductase activity (By similarity). Has broad substrate specificity and can catalyze the reduction of methylglyoxal, 9,10-phenanthrenequinone, prostaglandin J2, 4-nitrobenzaldehyde, 4-nitroacetophenone and 4-oxo-trans-2-nonenal (in vitro) (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region, compared to variant 1. Both variants 3 and 4 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...