Sh3glb1 (NM_001282042) Mouse Untagged Clone

CAT#: MC227243

Sh3glb1 (untagged) - Mouse SH3-domain GRB2-like B1 (endophilin) (Sh3glb1), transcript variant 3



  "NM_001282042" in other vectors (1)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Sh3glb1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA409932; AI314629; AU015566; Bif-1; mKIAA0491
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227243 representing NM_001282042
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACATCATGGATTTCAACGTGAAGAAGCTGGCGGCCGACGCGGGCACCTTCCTCAGCCGGGCCGTGC
AGTTCACAGAAGAAAAGCTTGGCCAGGCAGAGAAGACAGAACTGGACGCTCACCTGGAAAACCTCCTTAG
CAAAGCTGAATGTACCAAAATATGGACAGAAAAGATAATGAAGCAGACCGAAGTGCTGTTGCAGCCAAAT
CCAAATGCCAGGATAGAAGAATTTGTTTATGAGAAACTGGATAGAAAAGCACCAAGTCGTATAAACAACC
CGGAACTTTTGGGACAATATATGATTGATGCAGGAACTGAGTTTGGCCCAGGGACAGCTTATGGAAATGC
CCTTATTAAATGTGGAGAAACACAGAAGCGAATTGGAACAGCTGACCGAGAGCTGATTCAAACATCAGCC
TTAAATTTCCTCACTCCTTTAAGAAACTTTATAGAAGGGGATTACAAAACAATCGCAAAAGAAAGGAAAC
TATTACAGAATAAGAGACTGGATTTGGATGCTGCAAAAACAAGACTAAAAAAGGCAAAAGCTGCAGAAAC
TAAAAGTTCATCTGAACAGGAATTGAGAATAACTCAAAGTGAATTTGATCGTCAGGCAGAGATTACCCGA
CTCCTGCTTGAGGGAATCAGCAGTACACACGCCCATCATCTCCGCTGTCTGAATGACTTTGTAGAAGCCC
AGATGACTTACTATGCACAGTGTTACCAGTATATGCTAGACCTACAGAAGCAACTGGGAAGTTTTCCATC
CAATTATCTTTCTAACAACAATCAGACCTCTGGGACACCAGTGCCATATGCTTTGTCAAATGCAATTGGT
CCTTCTGCCCAGGCTTCAACGGGTAGCCTTGTAATCACCTGTCCTTCTAACCTCAATGACCTTAAAGAAT
CCAGCAACAACAGGAAGGCTAGGGTCCTCTATGATTATGATGCTGCAAATAGCACTGAACTGTCACTCCT
GGCCGATGAGGTAATCACTGTGTTCAGTGTCGTTGGAATGGACTCCGACTGGCTAATGGGAGAGAGAGGA
AATCAAAAGGGCAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001282042
Insert Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282042.1, NP_001268971.1
RefSeq Size 2809 bp
RefSeq ORF 1068 bp
Locus ID 54673
UniProt ID Q9JK48
Gene Summary May be required for normal outer mitochondrial membrane dynamics. Required for coatomer-mediated retrograde transport in certain cells (PubMed:17086176). May recruit other proteins to membranes with high curvature. May promote membrane fusion (By similarity). Involved in activation of caspase-dependent apoptosis by promoting BAX/BAK1 activation (PubMed:16227588). Isoform 1 acts proapoptotic in fibroblasts (PubMed:24523556). Involved in caspase-independent apoptosis during nutrition starvation and involved in the regulation of autophagy. Activates lipid kinase activity of PIK3C3 during autophagy probably by associating with the PI3K complex II (PI3KC3-C2). Associated with PI3KC3-C2 during autophagy may regulate the trafficking of ATG9A from the Golgi complex to the peripheral cytoplasm for the formation of autophagosomes by inducing Golgi membrane tubulation and fragmentation. Involved in regulation of degradative endocytic trafficking and cytokinesis, probably in the context of PI3KC3-C2 (By similarity). Isoform 2 acts antiapoptotic in neuronal cells; involved in maintenance of mitochondrial morphology and promotes neuronal viability (PubMed:24523556).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site and alternate exon in the 3' coding region, compared to variant 1. The encoded protein (isoform 3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...