Mdm2 (NM_001288586) Mouse Untagged Clone

CAT#: MC227712

Mdm2 (untagged) - Mouse transformed mouse 3T3 cell double minute 2 (Mdm2), transcript variant 2



  "NM_001288586" in other vectors (1)

CNY 4,280.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-MDM2 antibody
    • 100 ug

CNY 8,025.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700007J15Rik; AA415488; Mdm-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227712 representing NM_001288586
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGAGATTATATTTTATATTGGCCAGTATATTATGACTAAGAGGTTATATGACGAGAAGCAGCAGC
ACATTGTGTATTGTTCAAATGATCTCCTAGGAGATGTGTTTGGAGTCCCGAGTTTCTCTGTGAAGGAGCA
CAGGAAAATATATGCAATGATCTACAGAAATTTAGTGGCTGTAAGTCAGCAAGACTCTGGCACATCGCTG
AGTGAGAGCAGACGTCAGCCTGAAGGTGGGAGTGATCTGAAGGATCCTTTGCAAGCGCCACCAGAAGAGA
AACCTTCATCTTCTGATTTAATTTCTAGACTGTCTACCTCATCTAGAAGGAGATCCATTAGTGAGACAGA
AGAGAACACAGATGAGCTACCTGGGGAGCGGCACCGGAAGCGCCGCAGGTCCCTGTCCTTTGATCCGAGC
CTGGGTCTGTGTGAGCTGAGGGAGATGTGCAGCGGCGGCAGCAGCAGCAGTAGCAGCAGCAGCAGCGAGT
CCACAGAGACGCCCTCGCATCAGGATCTTGACGATGGCGTAAGTGAGCATTCTGGTGATTGCCTGGATCA
GGATTCAGTTTCTGATCAGTTTAGCGTGGAATTTGAAGTTGAGTCTCTGGACTCGGAAGATTACAGCCTG
AGTGACGAAGGGCACGAGCTCTCAGATGAGGATGATGAGGTCTATCGGGTCACAGTCTATCAGACAGGAG
AAAGCGATACAGACTCTTTTGAAGGAGATCCTGAGATTTCCTTAGCTGACTATTGGAAGTGTACCTCATG
CAATGAAATGAATCCTCCCCTTCCATCACACTGCAAAAGATGCTGGACCCTTCGTGAGAACTGGCTTCCA
GACGATAAGGGGAAAGATAAAGTGGAAATCTCTGAAAAAGCCAAACTGGAAAACTCAGCTCAGGCAGAAG
AAGGCTTGGATGTGCCTGATGGCAAAAAGCTGACAGAGAATGATGCTAAAGAGCCATGTGCTGAGGAGGA
CAGCGAGGAGAAGGCCGAACAGACGCCCCTGTCCCAGGAGAGTGACGACTATTCCCAACCATCGACTTCC
AGCAGCATTGTTTATAGCAGCCAAGAAAGCGTGAAAGAGTTGAAGGAGGAAACGCAGGACAAAGACGAGA
GTGTGGAATCTAGCTTCTCCCTGAATGCCATCGAACCATGTGTGATCTGCCAGGGGCGGCCTAAAAATGG
CTGCATTGTTCACGGCAAGACTGGACACCTCATGTCATGTTTCACGTGTGCAAAGAAGCTAAAAAAAAGA
AACAAGCCCTGCCCAGTGTGCAGACAGCCAATCCAAATGATTGTGCTAACTTACTTCAACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001288586
Insert Size 1323 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288586.2, NP_001275515.1
RefSeq Size 3039 bp
RefSeq ORF 1323 bp
Locus ID 17246
UniProt ID P23804
Gene Summary E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the proteasome (PubMed:15195100, PubMed:21804542). Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its transcriptional activation domain (By similarity). Also acts as a ubiquitin ligase E3 toward itself, ARRB1 and ARBB2 (PubMed:11588219). Permits the nuclear export of p53/TP53 (By similarity). Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1 protein (By similarity). Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation (By similarity). Component of the TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53 (By similarity). Also component of the TRIM28/KAP1-ERBB4-MDM2 complex which links growth factor and DNA damage response pathways (By similarity). Mediates ubiquitination and subsequent proteasome degradation of DYRK2 in nucleus (By similarity). Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal degradation (By similarity). Ubiquitinates DCX, leading to DCX degradation and reduction of the dendritic spine density of olfactory bulb granule cells (PubMed:25088421). Ubiquitinates DLG4, leading to proteasomal degradation of DLG4 which is required for AMPA receptor endocytosis (PubMed:14642282).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an internal exon in the 5' region, which results in translation initiation at a downstream AUG start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...