Fanci (BC027836) Mouse Tagged ORF Clone
CAT#: MR206166
- TrueORF®
Fanci (Myc-DDK-tagged) - Mouse Fanconi anemia, complementation group I (cDNA clone IMAGE:5322726)
ORF Plasmid: tGFP
"BC027836" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 8,270.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR206166 representing BC027836
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | BC027836 |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027836 |
RefSeq Size | 4524 bp |
RefSeq ORF | 1184 bp |
Locus ID | 208836 |
MW | 165.9 kDa |
Gene Summary | Plays an essential role in the repair of DNA double-strand breaks by homologous recombination and in the repair of interstrand DNA cross-links (ICLs) by promoting FANCD2 monoubiquitination by FANCL and participating in recruitment to DNA repair sites. Required for maintenance of chromosomal stability. Specifically binds branched DNA: binds both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA). Participates in S phase and G2 phase checkpoint activation upon DNA damage.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC218552 | Fanci (untagged) - Mouse Fanconi anemia, complementation group I (cDNA clone IMAGE:5322726), (10ug) |
CNY 6,940.00 |
|
MG206166 | Fanci (tGFP-tagged) - Mouse Fanconi anemia, complementation group I (cDNA clone IMAGE:5322726) |
CNY 9,120.00 |
|
MR206166L3 | Lenti ORF clone of Fanci (Myc-DDK-tagged) - Mouse Fanconi anemia, complementation group I (cDNA clone IMAGE:5322726) |
CNY 10,170.00 |
|
MR206166L4 | Lenti ORF clone of Fanci (mGFP-tagged) - Mouse Fanconi anemia, complementation group I (cDNA clone IMAGE:5322726) |
CNY 10,170.00 |