CD89 (FCAR) (NM_133277) Human Tagged ORF Clone
CAT#: RC212950
- TrueORF®
FCAR (Myc-DDK-tagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 7
ORF Plasmid: tGFP
"NM_133277" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 3,990.00
CNY 300.00
Specifications
Product Data | |
Type | Human Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | CD89; CTB-61M7.2; FcalphaRI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RC212950 representing NM_133277
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACCCCAAACAGACCACCCTCCTGTGTCTTGGCTTGTATGGCAAACCCTTCCTCTCTGCAGATCGGG GTCTGGTGTTGATGCCAGGAGAGAATATTTCCCTCACGTGCAGCTCAGCACACATCCCATTTGATAGATT TTCACTGGCCAAGGAGGGAGAACTTTCTCTGCCACAGCACCAAAGTGGGGAACACCCGGCCAACTTCTCT TTGGGTCCTGTGGACCTCAATGTCTCAGGGATCTACAGGTGCTACGGTTGGTACAACAGGAGCCCCTACC TGTGGTCCTTCCCCAGTAATGCCTTGGAGCTTGTGGTCACAGACTCCATCCACCAAGATTACACGACGCA GAACTTGATCCGCATGGCCGTGGCAGGACTGGTCCTCGTGGCTCTCTTGGCCATACTGGTTGAAAATTGG CACAGCCATACGGCACTGAACAAGGAAGCCTCGGCAGATGTGGCTGAACCGAGCTGGAGCCAACAGATGT GTCAGCCAGGATTGACCTTTGCACGAACACCAAGTGTCTGCAAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites |
SgfI-MluI
Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_133277 |
ORF Size | 534 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_133277.4 |
RefSeq Size | 1344 bp |
RefSeq ORF | 537 bp |
Locus ID | 2204 |
UniProt ID | P24071 |
Protein Families | Transmembrane |
MW | 19.4 kDa |
Gene Summary | This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212950L3 | Lenti-ORF clone of FCAR (Myc-DDK-tagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 7 |
CNY 5,890.00 |
|
RC212950L4 | Lenti-ORF clone of FCAR (mGFP-tagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 7 |
CNY 5,890.00 |
|
RG212950 | FCAR (tGFP-tagged) - Human Fc fragment of IgA, receptor for (FCAR), transcript variant 7 |
CNY 4,240.00 |
|
SC109218 | FCAR (untagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 7 |
CNY 2,400.00 |