Gpsm1 (NM_001145469) Rat Untagged Clone
CAT#: RN200163
Gpsm1 (untagged ORF) - Rat G-protein signaling modulator 1 (AGS3-like, C. elegans) (Gpsm1), transcript variant 2, (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Ags3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200163 representing NM_001145469
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATGACCAACGCTGTCCCCTGGAGGAAGGCCAGGCTGGGGCTGCTGAGGCTACAGCTGCCCCAACCC TGGAGGAGAGAGCGGCTCAGCCCTCTGTAACAGCTTCACCACAGACTGAAGAGTTCTTTGACCTCATTGC CAGCTCCCAGAGCCGCCGGCTGGATGACCAGAGGGCTAGCGTAGGCAGCCTGCCTGGGCTTCGCATCACC CTCAACAACGTGGGGCACCTCCGAGGCGACGGGGACCCCCAGGAGCCAGGGGATGAGTTTTTCAACATGC TTATCAAATACCAGTCCTCCAGGATTGATGACCAGCGCTGTCCACCCCCTGATGTGCTGCCCCGAGGCCC CACCATGCCTGATGAGGATTTCTTCAGCCTTATCCAGAGGGTGCAGGCTAAGCGGATGGATGAGCAGCGT GTGGACCTGGCTGGGAGTCCAGACCAAGAGGCCAGTGGGCTGCCTGATCCCCGGCAGCAATGTCCGCCAG GTGCCAGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145469 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145469.1, NP_001138941.1 |
RefSeq Size | 1985 bp |
RefSeq ORF | 501 bp |
Locus ID | 246254 |
UniProt ID | Q9R080 |
Gene Summary | Guanine nucleotide dissociation inhibitor (GDI) which functions as a receptor-independent activator of heterotrimeric G-protein signaling. Keeps G(i/o) alpha subunit in its GDP-bound form thus uncoupling heterotrimeric G-proteins signaling from G protein-coupled receptors. Controls spindle orientation and asymmetric cell fate of cerebral cortical progenitors. May also be involved in macroautophagy in intestinal cells. May play a role in drug addiction.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2, also known as AGS3-SHORT-1) differs in the 5' UTR, lacks several exons in the 5' coding region and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200163 | Gpsm1 (Myc-DDK-tagged ORF) - Rat G-protein signaling modulator 1 (AGS3-like, C. elegans) (Gpsm1), transcript variant 2, (10 ug) |
CNY 3,990.00 |
|
RR200163L3 | Lenti ORF clone of Gpsm1 (Myc-DDK-tagged ORF) - Rat G-protein signaling modulator 1 (AGS3-like, C. elegans) (Gpsm1), transcript variant 2, (10 ug) |
CNY 6,080.00 |
|
RR200163L4 | Lenti ORF clone of Gpsm1 (mGFP-tagged ORF) - Rat G-protein signaling modulator 1 (AGS3-like, C. elegans) (Gpsm1), transcript variant 2, (10 ug) |
CNY 6,650.00 |