Gpsm1 (NM_001145469) Rat Untagged Clone

CAT#: RN200163

Gpsm1 (untagged ORF) - Rat G-protein signaling modulator 1 (AGS3-like, C. elegans) (Gpsm1), transcript variant 2, (10 ug)



  "NM_001145469" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Ags3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200163 representing NM_001145469
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGACCAACGCTGTCCCCTGGAGGAAGGCCAGGCTGGGGCTGCTGAGGCTACAGCTGCCCCAACCC
TGGAGGAGAGAGCGGCTCAGCCCTCTGTAACAGCTTCACCACAGACTGAAGAGTTCTTTGACCTCATTGC
CAGCTCCCAGAGCCGCCGGCTGGATGACCAGAGGGCTAGCGTAGGCAGCCTGCCTGGGCTTCGCATCACC
CTCAACAACGTGGGGCACCTCCGAGGCGACGGGGACCCCCAGGAGCCAGGGGATGAGTTTTTCAACATGC
TTATCAAATACCAGTCCTCCAGGATTGATGACCAGCGCTGTCCACCCCCTGATGTGCTGCCCCGAGGCCC
CACCATGCCTGATGAGGATTTCTTCAGCCTTATCCAGAGGGTGCAGGCTAAGCGGATGGATGAGCAGCGT
GTGGACCTGGCTGGGAGTCCAGACCAAGAGGCCAGTGGGCTGCCTGATCCCCGGCAGCAATGTCCGCCAG
GTGCCAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001145469
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145469.1, NP_001138941.1
RefSeq Size 1985 bp
RefSeq ORF 501 bp
Locus ID 246254
UniProt ID Q9R080
Gene Summary Guanine nucleotide dissociation inhibitor (GDI) which functions as a receptor-independent activator of heterotrimeric G-protein signaling. Keeps G(i/o) alpha subunit in its GDP-bound form thus uncoupling heterotrimeric G-proteins signaling from G protein-coupled receptors. Controls spindle orientation and asymmetric cell fate of cerebral cortical progenitors. May also be involved in macroautophagy in intestinal cells. May play a role in drug addiction.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2, also known as AGS3-SHORT-1) differs in the 5' UTR, lacks several exons in the 5' coding region and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...