Ensa (NM_021842) Rat Untagged Clone
CAT#: RN200330
Ensa (untagged ORF) - Rat endosulfine alpha (Ensa), transcript variant 2, (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN200330 representing NM_021842
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCCAGAAACAAGAAGAAGAAAACCCTGCGGAGGAAACCGGCGAGGAGAAGCAGGATACACAGGAGA AAGAAGGTATTCTTCCTGAGAAAGCTGAGGAAGCAAAGCTAAAGGCCAAATATCCAAGCCTAGGACAAAA GCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTAC AACATGGCCAAAGCCAAGATGAAGAACAAGCAGCTACCGAGTGCAGGAGCAGACAAGAACCTGGTGACCG GTGACCACATCCCCACCCCACAGGACCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGG TGGCCAAGTTGAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021842 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021842.3, NP_068614.1 |
RefSeq Size | 1186 bp |
RefSeq ORF | 366 bp |
Locus ID | 60334 |
UniProt ID | P60841 |
Gene Summary | may mediate insulin secretion through interaction with the pancreatic beta-cell ATP-sensitive potassium (K(ATP)) channel [RGD, Feb 2006] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region and a different 3' terminal exon compared to variant 1. The resulting protein (isoform 2) is longer and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR200330 | Ensa (Myc-DDK-tagged ORF) - Rat endosulfine alpha (Ensa), transcript variant 2, (10 ug) |
CNY 3,990.00 |
|
RR200330L3 | Lenti ORF clone of Ensa (Myc-DDK-tagged ORF) - Rat endosulfine alpha (Ensa), transcript variant 2, (10 ug) |
CNY 6,080.00 |
|
RR200330L4 | Lenti ORF clone of Ensa (mGFP-tagged ORF) - Rat endosulfine alpha (Ensa), transcript variant 2, (10 ug) |
CNY 6,650.00 |