Rnps1 (NM_001011890) Rat Untagged Clone

CAT#: RN201287

Rnps1 (untagged ORF) - Rat ribonucleic acid binding protein S1 (Rnps1), (10 ug)



  "NM_001011890" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201287 representing NM_001011890
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTTATCAGGAGTGAAAAAGAAGAGCTTGCTAGGAGTCAAAGAGAATAATAAAAAGTCCAGCACTA
GGGCTCCTTCTCCTACCAAACGAAAGGACCGCTCTGATGAGAAGTCCAAGGATCGATCTAAAGATAAAGG
GACCACTAAAGAGTCCAGTGAGAAGGATCGTGGCAGAGATAAGACCCGGAAGAGACGCAGTGCTTCAAGC
GGAAGCAGCAGCACCAGGTCCAGGTCCAGCTCAACCTCCAGCTCGGGCTCCAGCACCAGCACGGGCTCGA
GCAGTGGCTCTAGCTCGTCTTCTGCGTCCAGCCGCTCAGGAAGCTCCAGCACATCCCGGAGCTCCAGTTC
CAGCAGCTCCTCCGGCTCCCCAAGCCCTTCTCGGCGCAGACATGACAACAGGCGGCGTTCCCGCTCCAAA
TCCAAACCACCTAAAAGAGATGAAAAAGAGAGGAAAAGGCGGAGCCCTTCACCTAAACCCACCAAAGTGC
ACATTGGGAGGCTCACCAGGAATGTGACCAAGGATCATATCATGGAAATATTTTCTACTTACGGGAAAAT
TAAAATGATTGACATGCCTGTGGAAAGGATGCATCCTCATCTATCCAAAGGCTATGCGTACGTGGAATTC
GAGAATCCGGATGAAGCAGAGAAGGCACTGAAACACATGGATGGAGGACAAATAGATGGCCAAGAGATCA
CTGCTACTGCGGTGTTGGCACCCTGGCCTCGTCCACCGCCTCGGCGATTCAGCCCACCCAGGAGAATGCT
TCCACCGCCTCCCATGTGGCGTAGGTCACCCCCACGGATGAGGAGAAGGTCTCGATCCCCAAGACGCAGG
TCCCCTGTGCGAAGGAGGTCTCGATCGCCTGGCCGCCGCCGCCACAGGAGCCGATCCAGCTCCAACTCCT
CCCGATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001011890
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001011890.1, NP_001011890.1
RefSeq Size 1853 bp
RefSeq ORF 918 bp
Locus ID 287113
UniProt ID Q6AYK1
Gene Summary Part of pre- and post-splicing multiprotein mRNP complexes. Auxiliary component of the splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junction on mRNAs. The EJC is a dynamic structure consisting of core proteins and several peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. Component of the ASAP and PSAP complexes which bind RNA in a sequence-independent manner and are proposed to be recruited to the EJC prior to or during the splicing process and to regulate specific excision of introns in specific transcription subsets. The ASAP complex can inhibit RNA processing during in vitro splicing reactions. The ASAP complex promotes apoptosis and is disassembled after induction of apoptosis. Enhances the formation of the ATP-dependent A complex of the spliceosome. Involved in both constitutive splicing and, in association with SRP54 and TRA2B/SFRS10, in distinctive modulation of alternative splicing in a substrate-dependent manner. Involved in the splicing modulation of BCL2L1/Bcl-X (and probably other apoptotic genes); specifically inhibits formation of proapoptotic isoforms such as Bcl-X(S); the activity is different from the established EJC assembly and function. Participates in mRNA 3'-end cleavage. Involved in UPF2-dependent nonsense-mediated decay (NMD) of mRNAs containing premature stop codons. Also mediates increase of mRNA abundance and translational efficiency. Binds spliced mRNA 20-25 nt upstream of exon-exon junctions (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...