Pclaf (NM_201418) Rat Untagged Clone
CAT#: RN202132
Ns5atp9 (untagged ORF) - Rat NS5A (hepatitis C virus) transactivated protein 9 (Ns5atp9), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Ns5atp9; Paf; PAF15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN202132 representing NM_201418
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTCGGACCAAAGCAAACTACGTCCCAGGAGCCTACAGAAAAGTGGTGGCTTCTCAAGCCCCTAGGA AGGTGCTTGGCTCCTCCACCTTTGTCACCAATTCTTCCGGTTCGTCGAGAAAAGCTGAAAATAAGTATGC TGGAGGGAACCCAGTCTGTGTGCGCCCAACTCCCAAGTGGCAAAAAGGCATCGGGGAATTCTTCAGGTTG TCCCCTAAAGATTCTAAAAAAGAAAACCAGATTCCTGAAGAAGCAGGAAGCAGTGGCTTAGGAAAAGCAA AGAGAAAAGCATGTCCTTTGCAACCTGATCACAGAGATGATGAAAATGAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_201418 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_201418.1, NP_958821.1 |
RefSeq Size | 333 bp |
RefSeq ORF | 333 bp |
Locus ID | 300795 |
UniProt ID | Q6RIA2 |
Gene Summary | PCNA-binding protein that acts as a regulator of DNA repair during DNA replication. Following DNA damage, the interaction with PCNA is disrupted, facilitating the interaction between monoubiquitinated PCNA and the translesion DNA synthesis DNA polymerase eta (POLH) at stalled replisomes, facilitating the bypass of replication-fork-blocking lesions. Also acts as a regulator of centrosome number (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR202132 | Ns5atp9 (Myc-DDK-tagged ORF) - Rat NS5A (hepatitis C virus) transactivated protein 9 (Ns5atp9), (10 ug) |
CNY 3,990.00 |
|
RR202132L3 | Lenti ORF clone of Ns5atp9 (Myc-DDK-tagged ORF) - Rat NS5A (hepatitis C virus) transactivated protein 9 (Ns5atp9), (10 ug) |
CNY 6,080.00 |
|
RR202132L4 | Lenti ORF clone of Ns5atp9 (mGFP-tagged ORF) - Rat NS5A (hepatitis C virus) transactivated protein 9 (Ns5atp9), (10 ug) |
CNY 6,650.00 |