Myl2 (NM_001035252) Rat Untagged Clone

CAT#: RN202291

Myl2 (untagged ORF) - Rat myosin, light polypeptide 2, regulatory, cardiac, slow (Myl2), (10 ug)



  "NM_001035252" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Mlc-2; MLC-2s/v; Mlc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN202291 representing NM_001035252
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACCAAAGAAAGCCAAGAAGAGGTTAGAGGGCGGAAGCTCCAACGTGTTCTCCATGTTTGAGCAGA
CCCAGATCCAGGAGTTCAAGGAGGCCTTCACAATCATGGACCAGAACAGAGACGGCTTCATTGACAAGAA
TGACCTAAGGGACACGTTTGCTGCCCTCGGACGAGTGAACGTGAAAAACGAAGAGATCGATGAGATGATC
AAAGAGGCTCCAGGTCCAATTAACTTCACTGTGTTCCTCACCATGTTTGGGGAGAAACTTAAAGGAGCTG
ACCCGGAGGAGACCATTCTCAACGCCTTCAAGGTGTTTGACCCCGAAGGCAAAGGGTCGCTGAAGGCCGA
CTATGTCCGGGAGATGCTGACCACGCAAGCAGAGAGGTTCTCCAAAGAAGAGATCGACCAGATGTTCGCA
GCTTTTCCCCCTGACGTCACCGGCAACCTTGATTATAAGAATTTGGTTCACATCATCACCCACGGAGAAG
AGAAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001035252
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001035252.2, NP_001030329.2
RefSeq Size 677 bp
RefSeq ORF 501 bp
Locus ID 363925
UniProt ID P08733
Gene Summary Contractile protein that plays a role in heart development and function (By similarity). Following phosphorylation, plays a role in cross-bridge cycling kinetics and cardiac muscle contraction by increasing myosin lever arm stiffness and promoting myosin head diffusion; as a consequence of the increase in maximum contraction force and calcium sensitivity of contraction force. These events altogether slow down myosin kinetics and prolong duty cycle resulting in accumulated myosins being cooperatively recruited to actin binding sites to sustain thin filament activation as a means to fine-tune myofilament calcium sensitivity to force (PubMed:15331360). During cardiogenesis plays an early role in cardiac contractility by promoting cardiac myofibril assembly (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...