United States
Germany
Japan
United Kingdom
China
Rps27a (NM_031113) Rat Untagged Clone
CAT＃: RN203186
Rps27a (untagged ORF) - Rat ribosomal protein S27a (Rps27a), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Uba52; Ubb |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN203186 representing NM_031113
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGATTTTTGTGAAGACCCTTACAGGGAAGACCATCACGCTCGAGGTTGAACCCTCGGACACTATAG AAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGGTTGATCTTTGCTGG TAAGCAGTTGGAAGATGGCCGTACTTTGTCTGACTACAACATTCAAAAGGAGTCCACTCTCCATCTCGTG CTGAGACTTCGTGGTGGCGCTAAGAAAAGGAAGAAGAAGTCTTACACCACCCCAAAGAAGAACAAGCATA AGAGAAAGAAGGTCAAGTTGGCTGTGCTGAAATACTATAAGGTGGATGAAAATGGCAAAATCAGCCGACT TCGTCGGGAATGTCCTTCTGATGAATGTGGTGCTGGAGTTTTCATGGGTAGCCACTTTGACAGGCATTAC TGTGGCAAGTGTTGTCTGACTTACTGCTTCAACAAACCAGAAGACAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_031113 |
| Insert Size | 471 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_031113.2, NP_112375.1 |
| RefSeq Size | 996 bp |
| RefSeq ORF | 471 bp |
| Locus ID | 100912032 |
| UniProt ID | P62982 |
| Gene Summary | The protein encoded by this gene is a fusion protein that contains ubiquitin at its N-terminus and ribosomal protein S27a at its C-terminus. When the human ortholog of this protein is expressed in yeast, it is processed post-translationally into two products, a free ubiquitin monomer and ribosomal protein S27a, a component of the 40S ribosomal subunit. There are multiple pseudogenes of this gene. There is a locus on chromosome 5 (GeneID:81777) that contains an intact copy of the open reading frame of this gene, that is likely to be the result of retrotransposition of an mRNA into the genome. The transcriptional status of this locus cannot be verified at the present time. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR203186 | Rps27a (Myc-DDK-tagged ORF) - Rat ribosomal protein S27a (Rps27a), (10 ug) |
CNY 3,990.00 |
|
| RR203186L3 | Lenti ORF clone of Rps27a (Myc-DDK-tagged ORF) - Rat ribosomal protein S27a (Rps27a), (10 ug) |
CNY 6,080.00 |
|
| RR203186L4 | Lenti ORF clone of Rps27a (mGFP-tagged ORF) - Rat ribosomal protein S27a (Rps27a), (10 ug) |
CNY 6,650.00 |
