Arhgdia (NM_001007005) Rat Untagged Clone

CAT#: RN204316

Arhgdia (untagged ORF) - Rat Rho GDP dissociation inhibitor (GDI) alpha (Arhgdia), (10 ug)



  "NM_001007005" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Bles01
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204316 representing NM_001007005
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGAACAGGAACCCACTGCTGAGCAGCTCGCTCAGATAGCTGCAGAGAATGAGGAAGACGAGCACT
CTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGATGATGAAAG
CCTTCGAAAGTACAAGGAGGCCCTGCTGGGCCGAGTAGCTGTCTCTGCAGACCCCAATGTCCCCAACGTC
ATTGTGACCCGCTTGACCTTGGTGTGCAGCACTGCCCCAGGCCCTCTGGAACTGGACCTGACAGGTGATC
TGGAGAGCTTCAAGAAACAGTCATTTGTGTTGAAGGAAGGTGTGGAGTACCGGATAAAAATCTCTTTCCG
GGTGAACAGAGAGATCGTGTCAGGCATGAAGTACATCCAGCACACATACAGGAAAGGGGTCAAAATTGAC
AAGACTGACTACATGGTCGGGAGCTATGGGCCAAGGGCTGAGGAGTATGAGTTCCTGACACCCATGGAAG
AGGCCCCCAAAGGCATGCTTGCTCGGGGCAGTTACAACATCAAGTCCCGCTTCACAGATGATGACAAAAC
TGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAAAAGGAATGGAAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007005
Insert Size 615 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007005.1, NP_001007006.1
RefSeq Size 1963 bp
RefSeq ORF 615 bp
Locus ID 360678
UniProt ID Q5XI73
Gene Summary Controls Rho proteins homeostasis. Regulates the GDP/GTP exchange reaction of the Rho proteins by inhibiting the dissociation of GDP from them, and the subsequent binding of GTP to them. Retains Rho proteins such as CDC42, RAC1 and RHOA in an inactive cytosolic pool, regulating their stability and protecting them from degradation. Actively involved in the recycling and distribution of activated Rho GTPases in the cell, mediates extraction from membranes of both inactive and activated molecules due its exceptionally high affinity for prenylated forms. Through the modulation of Rho proteins, may play a role in cell motility regulation. In glioma cells, inhibits cell migration and invasion by mediating the signals of SEMA5A and PLXNB3 that lead to inactivation of RAC1.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...