United States
Germany
Japan
United Kingdom
China
Pnrc2 (NM_001103360) Rat Untagged Clone
CAT＃: RN204917
Pnrc2 (untagged ORF) - Rat proline-rich nuclear receptor coactivator 2 (Pnrc2), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGC93828 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN204917 representing NM_001103360
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTGGTGGAGAGAGGTATAACATTCCAGACCCTCAATCTAGAAATGCTAGCAAGAACCAACAACAGC ACAATAGACAGAAGACCAAGGATCAGAATTCCCAGATGAAGATCGTTCATAAGAAAAAGGAAAGAGGACA TGGGTACAATCCATCGGCAGTGCAAAATGGGGGAAAAACCAAGAGCCTTTCCAACAACTCCAACTGGAAT GCTAGCTTATCAAGTCCTAGCTTGCTTTTTAAGTCTCAAGCTAGTCAGAACTATGCTGGAGCCAAATTTA GTGAACCACCATCACCAAGTGTTCTCCCCAAGCCACCAAGCCACTGGGTTCATGTTTCCTTGAACCCTTC AGATAAGGAAACGATGACATTTCAACTTAAAACCTTACTTAAAGTACAGGTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001103360 |
| Insert Size | 405 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001103360.1, NP_001096830.1 |
| RefSeq Size | 1899 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 100125373 |
| UniProt ID | Q66HE1 |
| Gene Summary | Involved in nonsense-mediated mRNA decay (NMD) by acting as a bridge between the mRNA decapping complex and the NMD machinery. May act by targeting the NMD machinery to the P-body and recruiting the decapping machinery to aberrant mRNAs. Required for UPF1/RENT1 localization to the P-body. Plays a role in glucocorticoid receptor-mediated mRNA degradation by interacting with the glucocorticoid receptor NR3C1 in a ligand-dependent manner when it is bound to the 5' UTR of target mRNAs and recruiting the RNA helicase UPF1 and the mRNA-decapping enzyme DCP1A, leading to RNA decay. Also acts as a nuclear receptor coactivator. May play a role in controlling the energy balance between energy storage and energy expenditure.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR204917 | Pnrc2 (Myc-DDK-tagged ORF) - Rat proline-rich nuclear receptor coactivator 2 (Pnrc2), (10 ug) |
CNY 3,990.00 |
|
| RR204917L3 | Lenti ORF clone of Pnrc2 (Myc-DDK-tagged ORF) - Rat proline-rich nuclear receptor coactivator 2 (Pnrc2), (10 ug) |
CNY 6,080.00 |
|
| RR204917L4 | Lenti ORF clone of Pnrc2 (mGFP-tagged ORF) - Rat proline-rich nuclear receptor coactivator 2 (Pnrc2), (10 ug) |
CNY 6,650.00 |
