Mpz (NM_017027) Rat Untagged Clone
CAT#: RN204943
Mpz (untagged ORF) - Rat myelin protein zero (Mpz), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | MPP; P0 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN204943 representing NM_017027
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTCCTGGGGCTCCCTCATCCAGCCCCAGCCCTATCCTGGCTGCCCTGCTCTTCTCTTCTTTGGTGC TGTCCCCAACCCTGGCCATTGTGGTTTACACGGACAGGGAAGTCTATGGTGCTGTGGGCTCCCAGGTGAC CCTGCACTGCTCCTTCTGGTCCAGTGAATGGGTCTCAGATGACATCTCTTTTACCTGGCGCTACCAGCCT GAAGGAGGCCGAGATGCCATTTCAATCTTCCACTATGCCAAGGGTCAACCTTACATCGATGAGGTGGGGA CCTTCAAGGAGCGCATCCAGTGGGTAGGGGACCCTAGCTGGAAGGATGGCTCCATTGTCATACACAACCT AGACTACAGTGACAACGGCACTTTCACATGTGATGTCAAAAACCCACCGGACATAGTGGGCAAGACGTCT CAGGTCACGCTCTATGTCTTTGAAAAAGTGCCCACTAGGTATGGGGTGGTGTTGGGAGCCGTGATCGGTG GCATCCTCGGGGTGGTGCTGTTGCTGCTGTTGCTCTTCTACCTGATCCGGTACTGCTGGCTGCGCAGGCA GGCTGCCCTGCAGAGGAGGCTCAGTGCCATGGAGAAGGGGAAATTTCACAAGTCTTCTAAGGACTCCTCG AAGCGCGGGCGGCAGACGCCAGTGCTGTATGCCATGCTGGACCACAGCCGAAGCACCAAAGCTGCCAGTG AGAAGAAATCTAAAGGGCTGGGGGAGTCTCGCAAGGATAAGAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_017027 |
Insert Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_017027.2, NP_058723.2 |
RefSeq Size | 2018 bp |
RefSeq ORF | 747 bp |
Locus ID | 24564 |
UniProt ID | P06907 |
Gene Summary | This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in the orthologous gene in human are associated with myelinating neuropathies. A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2015] Transcript Variant: This transcript (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (MPZ, also known as P0) results from translation termination at the upstream UAG stop codon, while the longer isoform (L-MPZ) results from UAG stop codon readthrough to the downstream UGA termination codon. This RefSeq represents the shorter isoform (MPZ). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR204943 | Mpz (Myc-DDK-tagged ORF) - Rat myelin protein zero (Mpz), (10 ug) |
CNY 3,990.00 |
|
RR204943L3 | Lenti ORF clone of Mpz (Myc-DDK-tagged ORF) - Rat myelin protein zero (Mpz), (10 ug) |
CNY 6,080.00 |
|
RR204943L4 | Lenti ORF clone of Mpz (mGFP-tagged ORF) - Rat myelin protein zero (Mpz), (10 ug) |
CNY 6,650.00 |