Pef1 (NM_001007651) Rat Untagged Clone

CAT#: RN205054

Pef1 (untagged ORF) - Rat penta-EF hand domain containing 1 (Pef1), (10 ug)



  "NM_001007651" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Peflin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN205054 representing NM_001007651
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCTATCCAGACGGGCAGAGTTACCCAGGAGCTGCAGGACAGGTACCTGGACCACACCCCGGTG
GCTACTATCCTGGACCTCCCCATGGTGGGGGCCAGTATGGCAGTGGATTCCCCCCTGGTGGTTACGGAGC
TCCTGCCCCTGGAGGACCCTATGGCTACCCCAGTGCTGGAGGAACCCCCTCTGGAACTCCAGGCGGACCA
TATGGCGGTGGACCTCCAGGAGGCCCCTATGGTGGTGGACCTCCAGGAGGCCCCTATGGTCAGGCACATC
CAAGTCCCTATGGTACCCAGCCGCCTGGACCTTATGGACAGGGTGGCGTCCCCCCCAATGTCGATCCTGA
GGCCTACTCCTGGTTCCAGTCAGTGGATGCCGACCACAGTGGCTATATCTCACTCAAGGAGCTGAAGCAG
GCCCTGGTCAACTCCAACTGGTCCTCATTCAATGATGAGACGTGCCTCATGATGATAAACATGTTTGACA
AGACCAAGACTGGCCGAATTGATGTCGTCGGCTTCTCAGCCTTATGGAAGTTCCTCCAGCAGTGGAAGAA
CCTCTTTCAGCAGTATGACCGGGACCACTCGGGATCCATCAGCTCCACAGAGCTGCAGCAAGCGCTGTCC
CAGATGGGCTACAACCTGAGCCCTCAGTTCACGCAGCTCCTGGTTTCCCGATACTGTACGCGCTCTGCCA
TTCCCGCCATGCAGCTGGACTGCTTCATCAAGGTGTGTACCCAGCTTCAGGTGTTGACTGAGGCCTTCCG
GGAGAAGGATACGGCTGTACAGGGCAACATCCGGCTCAGCTTTGAGGACTTTGTCACCATGACGGCTTCA
AGGATGCTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007651
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007651.1, NP_001007652.1
RefSeq Size 1523 bp
RefSeq ORF 852 bp
Locus ID 297900
UniProt ID Q641Z8
Gene Summary Calcium-binding protein that acts as an adapter that bridges unrelated proteins or stabilizes weak protein-protein complexes in response to calcium. Together with PDCD6, acts as calcium-dependent adapter for the BCR(KLHL12) complex, a complex involved in endoplasmic reticulum (ER)-Golgi transport by regulating the size of COPII coats. In response to cytosolic calcium increase, the heterodimer formed with PDCD6 interacts with, and bridges together the BCR(KLHL12) complex and SEC31 (SEC31A or SEC31B), promoting monoubiquitination of SEC31 and subsequent collagen export, which is required for neural crest specification. Its role in the heterodimer formed with PDCD6 is however unclear: some evidence shows that PEF1 and PDCD6 work together and promote association between PDCD6 and SEC31 in presence of calcium. Other reports show that PEF1 dissociates from PDCD6 in presence of calcium, and may act as a negative regulator of PDCD6 (By similarity). Also acts as a negative regulator of ER-Golgi transport; possibly by inhibiting interaction between PDCD6 and SEC31 (PubMed:27276012).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...