United States
Germany
Japan
United Kingdom
China
Cby1 (NM_145676) Rat Untagged Clone
CAT＃: RN205230
Cby1 (untagged ORF) - Rat chibby homolog 1 (Drosophila) (Cby1), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | Pgea1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN205230 representing NM_145676
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTCTCTTTGGGAGCATATTCAGCCCGAAGAAGACTCCTCCTCGGAAGTCGGCCTCTCTCTCTAACC TGCACTCTTTAGATCGATCAACGCGAGAACTGGAGCTGGGTCTTGACTATGGAACTCCTACCATGAACCT GGCGGGGCAAAGCCTGAAGTTTGAAAATGGCCAGTGGGTGGCAGACTCAGTGATTAGTGGGGGTGTGGAC CGGAGGGAAACTCAGCGCCTGCGCAAACGAAACCAGCAGTTGGAAGAAGAGAACAATCTCCTGCGGCTGA AGGTGGACATCCTGCTGGACATGCTTTCAGAAACCACTGCTGAGTCCCACTTAAAGGACAAGGAACTGGA TGAACTGAAGATTACCAACCGCAGGAGGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_145676 |
| Insert Size | 384 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145676.1, NP_663709.1 |
| RefSeq Size | 472 bp |
| RefSeq ORF | 384 bp |
| Locus ID | 246768 |
| UniProt ID | Q8K4I6 |
| Gene Summary | Inhibits the Wnt/Wingless pathway by binding to CTNNB1/beta-catenin and inhibiting beta-catenin-mediated transcriptional activation through competition with TCF/LEF transcription factors. Has also been shown to play a role in regulating the intracellular trafficking of polycystin-2/PKD2 and possibly of other intracellular proteins. Promotes adipocyte and cardiomyocyte differentiation.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR205230 | Cby1 (Myc-DDK-tagged ORF) - Rat chibby homolog 1 (Drosophila) (Cby1), (10 ug) |
CNY 1,800.00 |
|
| RR205230L3 | Lenti ORF clone of Cby1 (Myc-DDK-tagged ORF) - Rat chibby homolog 1 (Drosophila) (Cby1), (10 ug) |
CNY 6,080.00 |
|
| RR205230L4 | Lenti ORF clone of Cby1 (mGFP-tagged ORF) - Rat chibby homolog 1 (Drosophila) (Cby1), (10 ug) |
CNY 6,650.00 |
