United States
Germany
Japan
United Kingdom
China
Cdc26 (NM_001013240) Rat Untagged Clone
CAT＃: RN205294
Cdc26 (untagged ORF) - Rat cell division cycle 26 (Cdc26), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | BWK-2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN205294 representing NM_001013240
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCGACGAAAGCCAACTCGCCTGGAGCTCAAGCTCGATGACATTGAGGAGTTCGAGAACATTCGAA AGGACCTGGAGGCCCGTAAGAAACAGAAGGAAGATGTGGAAGGTGTAGGAACTAGCGATGGAGAAGGAGC TGCTGGGCTCAGCAGTGACCCCAAGAGCCGGGAACAAATGATTAATGATCGAATTGGTTATAAACCCCAA CTTAAGACCAACAACCGCACATCTCAGTTTGGAAATTTTGAATTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001013240 |
| Insert Size | 258 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001013240.2, NP_001013258.1 |
| RefSeq Size | 1601 bp |
| RefSeq ORF | 258 bp |
| Locus ID | 366381 |
| UniProt ID | Q6YDN7 |
| Gene Summary | Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR205294 | Cdc26 (Myc-DDK-tagged ORF) - Rat cell division cycle 26 (Cdc26), (10 ug) |
CNY 3,990.00 |
|
| RR205294L3 | Lenti ORF clone of Cdc26 (Myc-DDK-tagged ORF) - Rat cell division cycle 26 (Cdc26), (10 ug) |
CNY 6,080.00 |
|
| RR205294L4 | Lenti ORF clone of Cdc26 (mGFP-tagged ORF) - Rat cell division cycle 26 (Cdc26), (10 ug) |
CNY 6,650.00 |
