Atg12 (NM_001038495) Rat Untagged Clone
CAT#: RN205679
Atg12 (untagged ORF) - Rat ATG12 autophagy related 12 homolog (S. cerevisiae) (Atg12), (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Apg12l |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN205679 representing NM_001038495
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGAAGACCCAGAGGCTGTGCTGCAGCTCCCCGCGGCTCCGGCTGCTGCGGCGGGCGAGAGCCTTT TGGAGCTCTCCCCAGAAACAGCCATCCCAGAGCCCCCGTCTTCGGTTGCAGTTTCGCCCGGTACGGAGGA ACCTCCCGGAGACACCAAGAAAAAAATTGACATCCTGCTGAAGGCTGTAGGAGACACTCCCATAATGAAA ACGAAGAAATGGGCTGTGGAGCGGACCCGGACTGTCCAAGCACTCATCGACTTCATCAGAAAATTCCTCA GACTGCTGGCCTCGGAGCAGTTGTTTATTTATGTGAATCAGTCCTTTGCCCCTTCCCCAGACCAAGAAGT TGGGACTCTATATGAGTGTTTTGGCAGTGATGGTAAACTGGTCCTACATTACTGCAAATCACAGGCATGG GGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001038495 |
Insert Size | 426 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001038495.1, NP_001033584.1 |
RefSeq Size | 2590 bp |
RefSeq ORF | 426 bp |
Locus ID | 361321 |
UniProt ID | Q2TBJ5 |
Gene Summary | Ubiquitin-like protein involved in autophagy vesicles formation. Conjugation with ATG5 through a ubiquitin-like conjugating system involving also ATG7 as an E1-like activating enzyme and ATG10 as an E2-like conjugating enzyme, is essential for its function. The ATG12-ATG5 conjugate acts as an E3-like enzyme which is required for lipidation of ATG8 family proteins and their association to the vesicle membranes. The ATG12-ATG5 conjugate also regulates negatively the innate antiviral immune response by blocking the type I IFN production pathway through direct association with RARRES3 and MAVS. Plays also a role in translation or delivery of incoming viral RNA to the translation apparatus (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR205679 | Atg12 (Myc-DDK-tagged ORF) - Rat ATG12 autophagy related 12 homolog (S. cerevisiae) (Atg12), (10 ug) |
CNY 3,990.00 |
|
RR205679L3 | Lenti ORF clone of Atg12 (Myc-DDK-tagged ORF) - Rat ATG12 autophagy related 12 homolog (S. cerevisiae) (Atg12), (10 ug) |
CNY 6,080.00 |
|
RR205679L4 | Lenti ORF clone of Atg12 (mGFP-tagged ORF) - Rat ATG12 autophagy related 12 homolog (S. cerevisiae) (Atg12), (10 ug) |
CNY 6,650.00 |