Dbp (NM_012543) Rat Untagged Clone

CAT#: RN207574

Dbp (untagged ORF) - Rat D site of albumin promoter (albumin D-box) binding protein (Dbp), (10 ug)



  "NM_012543" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms MGC105474
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN207574 representing NM_012543
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCGGCCTCTGAGCGACAGGACCCCGGGCCCCCTGCTGCTGGGTGGCCCGGCTGGGGCCCCCCCTG
GCGGGGGAGCGCTGCTTGGGCTGAGGAGCCTTCTGCAGGGAAACAGCAAGCCCAAAGAACCGGCCAGCTG
TCTCCTGAAGGAAAAGGAGCGCAAGGCAACTCTGCCCTCAGCCCCCGTCCCGGGACCCGTCCTGGAAACG
GCGGGCCCAGCGGATGCCCCAACTGGGGCGGTTAGTGGCGGTGGGTCCCCTCGGGGGCGCTCAGGGCCTG
TGGCTGGCCCGAGTCTTTTTGCGCCGCTGCTGTGGGAACGCACTTTGCCTTTCGGGGACGTGGAATACGT
GGACCTGGACGCCTTCTTGCTGGAGCACGGGCTACCGCCGAGCCCGCCGCCCCCCGGGGGCCTGTCGCCG
GCACCCTCTCCAGCGCGCACTCCCGCGCCCTCCCCCGGGCCCGGCTCTTGCAGCTCCTCTTCCCCCCGCT
CCTCGCCCGGGCACGCCCCCGCGCGGGCCACTCTGGGAGCCGCCGGCGGCCACCGCGCAGGCTTGACCTC
TAGGGACACACCCAGTCCTGTGGACCCAGACACCGTGGAGGTGCTAATGACCTTTGAACCTGATCCGGCT
GATCTTGCCCTGTCAAGCATTCCAGGCCATGAGACTTTTGACCCTCGGAGGCACCGCTTCTCAGAGGAGG
AATTGAAGCCTCAGCCAATCATGAAGAAGGCAAGGAAAGTCCAGGTGCCCGAGGAACAGAAGGATGAGAA
GTACTGGAGCCGGAGGTACAAGAACAATGAAGCAGCCAAGAGGTCGAGAGACGCAAGAAGACTCAAGGAG
AACCAGATATCTGTGCGGGCAGCCTTCCTGGAGAAGGAAAACGCCCTATTGCGGCAGGAGGTGGTGGCTG
TGCGGCAGGAGCTGTCCCACTACCGTGCTGTGCTTTCACGCTACCAGGCCCAACACGGGACACTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012543
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012543.3, NP_036675.1
RefSeq Size 1660 bp
RefSeq ORF 978 bp
Locus ID 24309
UniProt ID P16443
Gene Summary The protein encoded by this gene is a member of the Par bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, Cyp2a4, and Cyp2a5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythym genes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...