Hspa1b (NM_212504) Rat Untagged Clone

CAT#: RN213866

Hspa1b (untagged ORF) - Rat heat shock 70kD protein 1B (mapped) (Hspa1b), (10 ug)



  "NM_212504" in other vectors (3)

CNY 8,270.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Hsp70-1; Hsp70-2; HSP70.2; Hsp72; Hspa1; Hspa1a; Hspa2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213866 representing NM_212504
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAAGAAAACAGCGATCGGCATCGACCTGGGCACCACCTACTCGTGCGTGGGCGTGTTCCAGCACG
GCAAGGTGGAGATCATCGCCAACGACCAGGGCAACCGCACGACCCCCAGCTACGTGGCCTTCACCGACAC
CGAGCGGCTCATCGGGGACGCCGCCAAGAACCAGGTGGCGCTGAACCCGCAGAACACCGTGTTCGACGCG
AAGCGGCTGATCGGCCGCAAGTTCGGCGACCCGGTGGTGCAGTCGGACATGAAGCACTGGCCCTTCCAGG
TGGTGAACGACGGCGACAAGCCCAAGGTGCAGGTGAACTACAAGGGCGAGAACCGGTCGTTCTACCCGGA
GGAGATCTCGTCCATGGTGCTGACCAAGATGAAGGAGATCGCCGAGGCGTACCTGGGCCACCCGGTGACC
AACGCGGTGATCACCGTGCCCGCCTACTTCAACGACTCGCAGCGGCAGGCCACCAAGGACGCGGGCGTGA
TCGCGGGTCTGAACGTGCTGCGGATCATCAACGAGCCCACGGCGGCCGCCATCGCCTACGGGCTGGACCG
GACCGGCAAGGGCGAGCGCAACGTGCTCATCTTCGACCTGGGGGGCGGCACGTTCGACGTGTCCATCCTG
ACGATCGACGACGGCATCTTCGAGGTGAAGGCCACGGCGGGCGACACGCACCTGGGCGGGGAGGACTTCG
ACAACCGGCTGGTGAGCCACTTCGTGGAGGAGTTCAAGAGGAAGCACAAGAAGGACATCAGCCAGAACAA
GCGCGCGGTGCGGCGACTGCGCACGGCGTGCGAGAGGGCCAAGAGGACGCTGTCGTCCAGCACCCAGGCC
AGCCTGGAGATCGACTCTCTGTTCGAGGGCATCGACTTCTACACGTCCATCACGCGGGCGCGGTTCGAGG
AGCTGTGCTCGGACCTGTTCCGCGGCACGCTGGAGCCCGTGGAGAAGGCCCTGCGCGACGCCAAGCTGGA
CAAGGCGCAGATCCACGACCTGGTGCTGGTGGGCGGCTCGACGCGCATCCCCAAGGTGCAGAAGCTGCTG
CAGGACTTCTTCAACGGGCGCGACCTGAACAAGAGCATCAATCCGGACGAGGCGGTGGCCTACGGGGCGG
CGGTGCAGGCGGCCATCCTGATGGGGGACAAGTCGGAGAACGTGCAGGACCTGCTGCTGCTGGACGTGGC
GCCGCTGTCGCTGGGTCTGGAGACCGCGGGCGGCGTGATGACGGCGCTCATCAAGCGCAACTCCACCATC
CCCACCAAGCAGACGCAGACCTTCACCACCTACTCGGACAACCAGCCCGGGGTGCTGATCCAGGTGTACG
AGGGCGAGAGGGCCATGACGCGCGACAACAACCTGCTGGGGCGCTTCGAGTTGAGCGGCATCCCGCCGGC
TCCCAGGGGCGTGCCCCAGATCGAGGTGACCTTCGACATCGACGCCAACGGCATCCTGAACGTCACGGCC
ACTGACAAGAGCACCGGCAAGGCCAACAAGATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGG
AGATCGAGCGCATGGTGCAGGAGGCCGAGCGCTACAAGGCGGAGGACGAGGTGCAGCGCGAGAGGGTGGC
TGCCAAGAATGCGCTCGAGTCCTATGCCTTCAACATGAAGAGCGCCGTGGAGGACGAGGGTCTCAAGGGC
AAGATCAGCGAGGCTGACAAGAAGAAGGTGCTGGACAAGTGCCAGGAGGTCATCTCCTGGCTGGACTCTA
ACACGCTGGCTGAGAAAGAGGAGTTCGTGCACAAGCGGGAGGAGCTGGAGCGGGTGTGCAACCCGATCAT
CAGCGGGCTGTATCAGGGTGCGGGTGCTCCCGGGGCTGGGGGCTTCGGGGCCCAGGCGCCCAAGGGAGGC
TCTGGGTCGGGGCCCACCATCGAGGAGGTGGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_212504
Insert Size 1926 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_212504.1, NP_997669.1
RefSeq Size 5918 bp
RefSeq ORF 1926 bp
Locus ID 294254
UniProt ID P0DMW0
Gene Summary Molecular chaperone implicated in a wide variety of cellular processes, including protection of the proteome from stress, folding and transport of newly synthesized polypeptides, activation of proteolysis of misfolded proteins and the formation and dissociation of protein complexes. Plays a pivotal role in the protein quality control system, ensuring the correct folding of proteins, the re-folding of misfolded proteins and controlling the targeting of proteins for subsequent degradation. This is achieved through cycles of ATP binding, ATP hydrolysis and ADP release, mediated by co-chaperones. The co-chaperones have been shown to not only regulate different steps of the ATPase cycle, but they also have an individual specificity such that one co-chaperone may promote folding of a substrate while another may promote degradation. The affinity for polypeptides is regulated by its nucleotide bound state. In the ATP-bound form, it has a low affinity for substrate proteins. However, upon hydrolysis of the ATP to ADP, it undergoes a conformational change that increases its affinity for substrate proteins. It goes through repeated cycles of ATP hydrolysis and nucleotide exchange, which permits cycles of substrate binding and release. The co-chaperones are of three types: J-domain co-chaperones such as HSP40s (stimulate ATPase hydrolysis by HSP70), the nucleotide exchange factors (NEF) such as BAG1/2/3 (facilitate conversion of HSP70 from the ADP-bound to the ATP-bound state thereby promoting substrate release), and the TPR domain chaperones such as HOPX and STUB1. Maintains protein homeostasis during cellular stress through two opposing mechanisms: protein refolding and degradation. Its acetylation/deacetylation state determines whether it functions in protein refolding or protein degradation by controlling the competitive binding of co-chaperones HOPX and STUB1. During the early stress response, the acetylated form binds to HOPX which assists in chaperone-mediated protein refolding, thereafter, it is deacetylated and binds to ubiquitin ligase STUB1 that promotes ubiquitin-mediated protein degradation. Regulates centrosome integrity during mitosis, and is required for the maintenance of a functional mitotic centrosome that supports the assembly of a bipolar mitotic spindle. Enhances STUB1-mediated SMAD3 ubiquitination and degradation and facilitates STUB1-mediated inhibition of TGF-beta signaling. Essential for STUB1-mediated ubiquitination and degradation of FOXP3 in regulatory T-cells (Treg) during inflammation. Negatively regulates heat shock-induced HSF1 transcriptional activity during the attenuation and recovery phase period of the heat shock response.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...