United States
Germany
Japan
United Kingdom
China
Npy (NM_012614) Rat Untagged Clone
CAT＃: RN214992
Npy (untagged ORF) - Rat neuropeptide Y (Npy), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Synonyms | NPY02; RATNPY; RATNPY02 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN214992 representing NM_012614
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGCTAGGTAACAAACGAATGGGGCTGTGTGGACTGACCCTCGCTCTATCCCTGCTCGTGTGTTTGG GCATTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGC CAGATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGC CCTGAGACACTGATTTCAGATCTCTTAATGAGAGAAAGCACAGAAAATGCCCCCAGAACAAGGCTTGAAG ACCCTTCCATGTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_012614 |
| Insert Size | 297 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_012614.2, NP_036746.1 |
| RefSeq Size | 567 bp |
| RefSeq ORF | 297 bp |
| Locus ID | 24604 |
| UniProt ID | P07808 |
| Gene Summary | This gene encodes a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Studies in the rat model of depression (Flinders Sensitive Line) show that this gene is downregulated in the hippocampus and the prefrontal cortex compared to the control ((Flinders Resistant Line). Alternatively spliced transcript variants of this gene have been described, but the function of all the variants is not known. [provided by RefSeq, Jul 2012] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR214992 | Npy (Myc-DDK-tagged ORF) - Rat neuropeptide Y (Npy), (10 ug) |
CNY 3,990.00 |
|
| RR214992L3 | Lenti ORF clone of Npy (Myc-DDK-tagged ORF) - Rat neuropeptide Y (Npy), (10 ug) |
CNY 6,080.00 |
|
| RR214992L4 | Lenti ORF clone of Npy (mGFP-tagged ORF) - Rat neuropeptide Y (Npy), (10 ug) |
CNY 6,650.00 |
