CAPON (NOS1AP) (NM_014697) Human Untagged Clone
CAT#: SC107217
NOS1AP (untagged)-Human nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP), transcript variant 1
CNY 3,776.00
CNY 7,220.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 6330408P19Rik; CAPON; NPHS22 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_014697, the custom clone sequence may differ by one or more nucleotides
ATGCCTAGCAAAACCAAGTACAACCTTGTGGACGATGGGCACGACCTGCGGATCCCCTTGCACAACGAGG ACGCCTTCCAGCACGGCATCTGCTTTGAGGCCAAGTACGTAGGAAGCCTGGACGTGCCAAGGCCCAACAG CAGGGTGGAGATCGTGGCTGCCATGCGCCGGATACGGTATGAGTTTAAAGCCAAGAACATCAAGAAGAAG AAAGTGAGCATTATGGTTTCAGTGGATGGAGTGAAAGTGATTCTGAAGAAGAAGAAAAAGCTTCTTTTAT TGCAGAAAAAGGAATGGACGTGGGATGAGAGCAAGATGCTGGTGATGCAGGACCCCATCTACAGGATCTT CTATGTCTCTCATGATTCCCAAGACTTGAAGATCTTCAGCTATATCGCTCGAGATGGTGCCAGCAATATC TTCAGGTGTAACGTCTTTAAATCCAAGAAGAAGAGCCAAGCTATGAGAATCGTTCGGACGGTGGGGCAGG CCTTTGAGGTCTGCCACAAGCTGAGCCTGCAGCACACGCAGCAGAATGCAGATGGCCAGGAAGATGGAGA GAGCGAGAGGAACAGCAACAGCTCAGGAGACCCAGGCCGCCAGCTCACTGGAGCCGAGAGGGCCTCCACG GCCACTGCAGAGGAGACTGACATCGATGCGGTGGAGGTCCCACTTCCAGGGAATGATGTCCTGGAATTCA GCCGAGGTGTGACTGATCTAGATGCTGTAGGGAAGGAAGGAGGCTCTCACACAGGCTCCAAGGTTTCGCA CCCCCAGGAGCCCATGCTGACAGCCTCACCCAGGATGCTGCTCCCTTCTTCTTCCTCGAAGCCTCCAGGC CTGGGCACAGAGACACCGCTGTCCACTCACCACCAGATGCAGCTCCTCCAGCAGCTCCTCCAGCAGCAGC AGCAGCAGACACAAGTGGCTGTGGCCCAGGTACACTTGCTGAAGGACCAGTTGGCTGCTGAGGCTGCGGC GCGGCTGGAGGCCCAGGCTCGCGTGCATCAGCTTTTGCTGCAGAACAAGGACATGCTCCAGCACATCTCC CTGCTGGTCAAGCAGGTGCAAGAGCTGGAACTGAAGCTGTCAGGACAGAACGCCATGGGCTCCCAGGACA GCTTGCTGGAGATCACCTTCCGCTCCGGAGCCCTGCCCGTGCTCTGTGACCCCACGACCCCTAAGCCAGA GGACCTGCATTCGCCGCCGCTGGGCGCGGGCTTGGCTGACTTTGCCCACCCTGCGGGCAGCCCCTTAGGT AGGCGCGACTGCTTGGTGAAGCTGGAGTGCTTTCGCTTTCTTCCGCCCGAGGACACCCCGCCCCCAGCGC AGGGCGAGGCGCTCCTGGGCGGTCTGGAGCTCATCAAGTTCCGAGAGTCAGGCATCGCCTCGGAGTACGA GTCCAACACGGACGAGAGCGAGGAGCGCGACTCGTGGTCCCAGGAGGAGCTGCCGCGCCTGCTGAATGTC CTGCAGAGGCAGGAACTGGGCGACGGCCTGGATGATGAGATCGCCGTGTAG |
Restriction Sites | Please inquire |
ACCN | NM_014697 |
Insert Size | 2600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014697.1, NP_055512.1 |
RefSeq Size | 2891 bp |
RefSeq ORF | 1521 bp |
Locus ID | 9722 |
UniProt ID | O75052 |
Gene Summary | This gene encodes a cytosolic protein that binds to the signaling molecule, neuronal nitric oxide synthase (nNOS). This protein has a C-terminal PDZ-binding domain that mediates interactions with nNOS and an N-terminal phosphotyrosine binding (PTB) domain that binds to the small monomeric G protein, Dexras1. Studies of the related mouse and rat proteins have shown that this protein functions as an adapter protein linking nNOS to specific targets, such as Dexras1 and the synapsins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (1) encodes the full-length protein (isoform 1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
NOS1AP Regulates Dendrite Patterning of Hippocampal Neurons through a Carboxypeptidase E-Mediated Pathway
,Damien Carrel, Yangzhou Du, Daniel Komlos, Norell M. Hadzimichalis, Munjin Kwon, Bo Wang, Linda M. Brzustowicz, and Bonnie L. Firestein,
J. Neurosci., Jun 2009; 29: 8248 - 8258.
[NOS1AP]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216122 | NOS1AP (Myc-DDK-tagged)-Human nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP), transcript variant 1 |
CNY 5,632.00 |
|
RC216122L3 | Lenti ORF clone of Human nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP), transcript variant 1, Myc-DDK-tagged |
CNY 6,460.00 |
|
RC216122L4 | Lenti ORF clone of Human nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP), transcript variant 1, mGFP tagged |
CNY 6,460.00 |
|
RG216122 | NOS1AP (tGFP-tagged) - Human nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP), transcript variant 1 |
CNY 7,232.00 |