PHOS (PDC) (NM_002597) Human Untagged Clone
CAT#: SC109562
PDC (untagged)-Human phosducin (PDC), transcript variant 1
CNY 3,840.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MEKA; PHD; PhLOP; PhLP |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002597, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAAGCCAAAAGCCAAAGTTTGGAGGAAGACTTTGAAGGACAGGCCACACATACAGGACCCAAAG GAGTAATAAATGATTGGAGAAAGTTTAAATTAGAGAGTCAAGACAGTGATTCAATTCCACCTAGCAAGAA GGAGATTCTCAGGCAAATGTCTTCTCCTCAGAGTAGGAATGGCAAAGATTCAAAGGAACGAGTCAGCAGA AAGATGAGCATTCAAGAATATGAACTAATCCATAAAGAGAAAGAGGATGAAAACTGCCTTCGTAAATACC GTAGACAGTGTATGCAGGATATGCACCAGAAGCTGAGTTTTGGGCCTAGATATGGGTTTGTGTATGAGCT GGAAACTGGAAAGCAATTCCTAGAAACAATTGAAAAGGAACTGAAGATCACCACAATTGTTGTTCACATT TATGAAGATGGTATTAAGGGTTGTGATGCTCTAAACAGTAGTTTAACATGCCTTGCAGCAGAATACCCTA TAGTTAAGTTTTGTAAAATAAAAGCTTCGAATACAGGTGCTGGGGACCGCTTTTCCTTAGATGTACTTCC TACACTGCTCATCTATAAAGGTGGGGAACTCATAAGCAATTTTATTAGTGTTGCTGAACAGTTTGCTGAA GAATTTTTTGCTGGGGATGTGGAGTCTTTCCTAAATGAATATGGGTTACTACCTGAAAGAGAGGTACATG TCCTAGAGCATACCAAAATAGAAGAAGAAGATGTTGAATGA |
Restriction Sites | NotI-NotI |
ACCN | NM_002597 |
Insert Size | 2500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002597.3, NP_002588.3 |
RefSeq Size | 1246 bp |
RefSeq ORF | 741 bp |
Locus ID | 5132 |
UniProt ID | P20941 |
Domains | Phosducin |
Protein Families | Druggable Genome |
Protein Pathways | Olfactory transduction |
Gene Summary | This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), also known as PHD, represents the longer transcript, and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222429 | PDC (Myc-DDK-tagged)-Human phosducin (PDC), transcript variant 1 |
CNY 3,990.00 |
|
RC222429L3 | Lenti-ORF clone of PDC (Myc-DDK-tagged)-Human phosducin (PDC), transcript variant 1 |
CNY 5,890.00 |
|
RC222429L4 | Lenti-ORF clone of PDC (mGFP-tagged)-Human phosducin (PDC), transcript variant 1 |
CNY 5,890.00 |
|
RG222429 | PDC (tGFP-tagged) - Human phosducin (PDC), transcript variant 1 |
CNY 4,370.00 |