GRO beta (CXCL2) (NM_002089) Human Untagged Clone
CAT#: SC118823
CXCL2 (untagged)-Human chemokine (C-X-C motif) ligand 2 (CXCL2)
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CINC-2a; GRO2; GROb; MGSA-b; MIP-2a; MIP2; MIP2A; SCYB2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC118823 representing NM_002089.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCGCGCCACGCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGGGTGGCGCTGCTGCTCCTG CTCCTGGTGGCCGCCAGCCGGCGCGCAGCAGGAGCGCCCCTGGCCACTGAACTGCGCTGCCAGTGCTTG CAGACCCTGCAGGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGC GCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCAGAAAGCTTGTCTCAACCCCGCATCGCCCATG GTTAAGAAAATCATCGAAAAGATGCTGAAAAATGGCAAATCCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002089 |
Insert Size | 324 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002089.3 |
RefSeq Size | 1234 bp |
RefSeq ORF | 324 bp |
Locus ID | 2920 |
UniProt ID | P19875 |
Domains | IL8 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, NOD-like receptor signaling pathway |
MW | 11.4 kDa |
Gene Summary | This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204877 | CXCL2 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 2 (CXCL2) |
CNY 1,200.00 |
|
RC204877L1 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 2 (CXCL2), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC204877L2 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 2 (CXCL2), mGFP tagged |
CNY 5,890.00 |
|
RC204877L3 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 2 (CXCL2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204877L4 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 2 (CXCL2), mGFP tagged |
CNY 5,890.00 |
|
RG204877 | CXCL2 (tGFP-tagged) - Human chemokine (C-X-C motif) ligand 2 (CXCL2) |
CNY 2,800.00 |
|
SC320418 | CXCL2 (untagged)-Human chemokine (C-X-C motif) ligand 2 (CXCL2) |
CNY 1,200.00 |
其它GRO beta产品