United States
Germany
Japan
United Kingdom
China
PRKAR2B (NM_002736) Human Untagged Clone
CAT＃: SC125501
PRKAR2B (untagged)-Human protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B)
CNY 5,488.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PRKAR2; RII-BETA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC125501 GCGATCGCCATGAGCATCGAGATCCCGGCGGGACTGACGGAGCTGCTGCAGGGCTTCACGGTGGAGGTGC
TGAGGCACCAGCCCGCGGACCTGCTGGAGTTCGCTCTGCAGCACTTCACCCGCCTGCAGCAGGAGAACGA GCGCAAAGGCACCGCGCGCTTCTGCCATGAGGGCAGGACCTGGGGGGACCTGGGCGCCGCTGCCGGGGGC GGCACCCCCAGCAAGGGGGTCAACTTCGCCGAGGAGCCCATGCAGTCCGACTCCGAGGACGGGGAGGAGG AGGAGGCGGCGCCCGCGGACGCAGGGGCGTTCAATGCTCCAGTAATAAACCGATTCACAAGGCGTGCCTC AGTATGTGCAGAAGCTTATAATCCTGATGAAGAAGAAGATGATGCAGAGTCCAGGATTATACATCCAAAA ACTGATGATCAAAGAAATAGGTTGCAAGAGGCTTGCAAAGACATCCTGCTGTTTAAGAATCTGGATCCGG AGCAGATGTCTCAAGTATTAGATGCCATGTTTGAAAAATTGGTCAAAGATGGGGAGCATGTAATTGATCA AGGTGACGATGGTGACAACTTTTATGTAATTGATAGAGGCACATTTGATATTTATGTGAAATGTGATGGT GTTGGAAGATGTGTTGGTAACTATGATAATCGTGGGAGTTTCGGCGAACTGGCCTTAATGTACAATACAC CCAGAGCAGCTACAATCACTGCTACCTCTCCTGGTGCTCTGTGGGGTTTGGACAGGGTAACCTTCAGGAG AATAATTGTGAAAAACAATGCCAAAAAGAGAAAAATGTATGAAAGCTTTATTGAGTCACTGCCATTCCTT AAATCTTTGGAGTTTTCTGAACGCCTGAAAGTAGTAGATGTGATAGGCACCAAAGTATACAACGATGGAG AACAAATCATTGCTCAGGGAGATTCGGCTGATTCTTTTTTCATTGTAGAATCTGGAGAAGTGAAAATTAC TATGAAAAGAAAGGGTAAATCAGAAGTGGAAGAGAATGGTGCAGTAGAAATCGCTCGATGCTCGCGGGGA CAGTACTTTGGAGAGCTTGCCCTGGTAACTAACAAACCTCGAGCAGCTTCTGCCCACGCCATTGGGACTG TCAAATGTTTAGCAATGGATGTGCAAGCATTTGAAAGGCTTCTGGGACCTTGCATGGAAATTATGAAAAG GAACATCGCTACCTATGAAGAACAGTTAGTTGCCCTGTTTGGAACGAACATGGATATTGTTGAACCCACT GCATGAACGCGT |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_002736 |
| Insert Size | 3520 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002736.2, NP_002727.2 |
| RefSeq Size | 3678 bp |
| RefSeq ORF | 1257 bp |
| Locus ID | 5577 |
| UniProt ID | P31323 |
| Domains | cNMP, RIIa |
| Protein Families | Druggable Genome |
| Protein Pathways | Apoptosis, Insulin signaling pathway |
| Gene Summary | cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Hypoxia and the hypoxia inducible factor 1α activate protein kinase A by repressing RII beta subunit transcription
,Lucia, K;Wu, Y;Garcia, JM;Barlier, A;Buchfelder, M;Saeger, W;Renner, U;Stalla, GK;Theodoropoulou, M;,
Oncogene
,PubMed ID 32111982
[PRKAR2B]
|
|
Regulation of cAMP-dependent Protein Kinases: THE HUMAN PROTEIN KINASE X (PrKX) REVEALS THE ROLE OF THE CATALYTIC SUBUNIT {alpha}H-{alpha}I LOOP
,Mandy Diskar, Hans-Michael Zenn, Alexandra Kaupisch, Melanie Kaufholz, Stefanie Brockmeyer, Daniel Sohmen, Marco Berrera, Manuela Zaccolo, Michael Boshart, Friedrich W. Herberg, and Anke Prinz,
J. Biol. Chem., Nov 2010; 285: 35910 - 35918
[PRKAR2B]
|
|
Selective modulation of PKA I and II reveals distinct roles in thyroid cell gene expression and growth
,Davide Calebiro, Tiziana de Filippis, Simona Lucchi, Fernando Martinez, Patrizia Porazzi, Roberta Trivellato, Massimo Locati, Paolo Beck-Peccoz, and Luca Persani,
Mol. Endocrinol., 2006 Dec;20(12):3196-211.
[PRKAR2B]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209900 | PRKAR2B (Myc-DDK-tagged)-Human protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B) |
CNY 5,488.00 |
|
| RC209900L3 | Lenti ORF clone of Human protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC209900L4 | Lenti ORF clone of Human protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B), mGFP tagged |
CNY 5,890.00 |
|
| RG209900 | PRKAR2B (tGFP-tagged) - Human protein kinase, cAMP-dependent, regulatory, type II, beta (PRKAR2B) |
CNY 7,088.00 |
其它PRKAR2B产品
