Presenilin 1 (PSEN1) (NM_000021) Human Untagged Clone
CAT#: SC125532
PSEN1 (untagged)-Human presenilin 1 (PSEN1), transcript variant 1
CNY 3,656.00
CNY 7,410.00
Cited in 4 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACNINV3; AD3; FAD; PS-1; PS1; S182 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC125532 sequence for NM_000021 edited (data generated by NextGen Sequencing)
ATGACAGAGTTACCTGCACCGTTGTCCTACTTCCAGAATGCACAGATGTCTGAGGACAAC CACCTGAGCAATACTGTACGTAGCCAGAATGACAATAGAGAACGGCAGGAGCACAACGAC AGACGGAGCCTTGGCCACCCTGAGCCATTATCTAATGGACGACCCCAGGGTAACTCCCGG CAGGTGGTGGAGCAAGATGAGGAAGAAGATGAGGAGCTGACATTGAAATATGGCGCCAAG CATGTGATCATGCTCTTTGTCCCTGTGACTCTCTGCATGGTGGTGGTCGTGGCTACCATT AAGTCAGTCAGCTTTTATACCCGGAAGGATGGGCAGCTAATCTATACCCCATTCACAGAA GATACCGAGACTGTGGGCCAGAGAGCCCTGCACTCAATTCTGAATGCTGCCATCATGATC AGTGTCATTGTTGTCATGACTATCCTCCTGGTGGTTCTGTATAAATACAGGTGCTATAAG GTCATCCATGCCTGGCTTATTATATCATCTCTATTGTTGCTGTTCTTTTTTTCATTCATT TACTTGGGGGAAGTGTTTAAAACCTATAACGTTGCTGTGGACTACATTACTGTTGCACTC CTGATCTGGAATTTTGGTGTGGTGGGAATGATTTCCATTCACTGGAAAGGTCCACTTCGA CTCCAGCAGGCATATCTCATTATGATTAGTGCCCTCATGGCCCTGGTGTTTATCAAGTAC CTCCCTGAATGGACTGCGTGGCTCATCTTGGCTGTGATTTCAGTATATGATTTAGTGGCT GTTTTGTGTCCGAAAGGTCCACTTCGTATGCTGGTTGAAACAGCTCAGGAGAGAAATGAA ACGCTTTTTCCAGCTCTCATTTACTCCTCAACAATGGTGTGGTTGGTGAATATGGCAGAA GGAGACCCGGAAGCTCAAAGGAGAGTATCCAAAAATTCCAAGTATAATGCAGAAAGCACA GAAAGGGAGTCACAAGACACTGTTGCAGAGAATGATGATGGCGGGTTCAGTGAGGAATGG GAAGCCCAGAGGGACAGTCATCTAGGGCCTCATCGCTCTACACCTGAGTCACGAGCTGCT GTCCAGGAACTTTCCAGCAGTATCCTCGCTGGTGAAGACCCAGAGGAAAGGGGAGTAAAA CTTGGATTGGGAGATTTCATTTTCTACAGTGTTCTGGTTGGTAAAGCCTCAGCAACAGCC AGTGGAGACTGGAACACAACCATAGCCTGTTTCGTAGCCATATTAATTGGTTTGTGCCTT ACATTATTACTCCTTGCCATTTTCAAGAAAGCATTGCCAGCTCTTCCAATCTCCATCACC TTTGGGCTTGTTTTCTACTTTGCCACAGATTATCTTGTACAGCCTTTTATGGACCAATTA GCATTCCATCAATTTTATATCTAG Clone variation with respect to NM_000021.3 |
Restriction Sites | NotI-NotI |
ACCN | NM_000021 |
Insert Size | 2700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | A TrueClone. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000021.2, NP_000012.1 |
RefSeq Size | 2763 bp |
RefSeq ORF | 1404 bp |
Locus ID | 5663 |
UniProt ID | P49768 |
Domains | Presenilin, PSN |
Protein Families | Druggable Genome, Protease, Transmembrane |
Protein Pathways | Alzheimer's disease, Neurotrophin signaling pathway, Notch signaling pathway, Wnt signaling pathway |
Gene Summary | Alzheimer's disease (AD) patients with an inherited form of the disease carry mutations in the presenilin proteins (PSEN1; PSEN2) or in the amyloid precursor protein (APP). These disease-linked mutations result in increased production of the longer form of amyloid-beta (main component of amyloid deposits found in AD brains). Presenilins are postulated to regulate APP processing through their effects on gamma-secretase, an enzyme that cleaves APP. Also, it is thought that the presenilins are involved in the cleavage of the Notch receptor, such that they either directly regulate gamma-secretase activity or themselves are protease enzymes. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene, the full-length nature of only some have been determined. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (1) encodes the longer isoform (I-467). |
Citations (4)
The use of this cDNA Clones has been cited in the following citations: |
---|
Nicastrin regulates breast cancer stem cell properties and tumor growth in vitro and in vivo
,Ylenia Lombardo, Aleksandra Filipovic, Gemma Molyneux, Manikandan Periyasamy, Georgios Giamas, Yunhui Hu, Pritesh S. Trivedi, Jayson Wang, Ernesto Yagüe, Loren Michel, and R. Charles Coombes,
PNAS, Oct 2012; 109: 16558 - 16563.
[PSEN1]
|
Presenilin-1 regulates induction of hypoxia inducible factor-1?: altered activation by a mutation associated with familial Alzheimer's disease
,null,
Molecular Neurodegeneration
,PubMed ID 20863403
[PSEN1]
|
Glucose and Endoplasmic Reticulum Calcium Channels Regulate HIF-1ß via Presenilin in Pancreatic ß-Cells
,Vardit Dror, Tatyana B. Kalynyak, Yaryna Bychkivska, Matthew H. Z. Frey, May Tee, Kristin D. Jeffrey, Vy Nguyen, Dan S. Luciani, and James D. Johnson,
J. Biol. Chem., Apr 2008; 283: 9909 - 9916.
[PSEN1]
|
Glucose and ER-calcium channels regulate HIF-1beta via presenilin in pancreatic beta -cells
,Vardit Dror, Tatyana B. Kalynyak, Yaryna Bychkivska, Matthew H. Z. Frey, May Tee, Kristin D. Jeffrey, Vy Nguyen, Dan S. Luciani, and James D. Johnson,
J. Biol. Chem. published 3 January 2008, 10.1074/jbc.M710601200
[PSEN1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216443 | PSEN1 (Myc-DDK-tagged)-Human presenilin 1 (PSEN1), transcript variant 1 |
CNY 5,488.00 |
|
RC216443L1 | Lenti ORF clone of Human presenilin 1 (PSEN1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC216443L2 | Lenti ORF clone of Human presenilin 1 (PSEN1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RC216443L3 | Lenti ORF clone of Human presenilin 1 (PSEN1), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC216443L4 | Lenti ORF clone of Human presenilin 1 (PSEN1), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG216443 | PSEN1 (tGFP-tagged) - Human presenilin 1 (PSEN1), transcript variant 1 |
CNY 7,088.00 |
其它Presenilin 1产品