Kallikrein 12 (KLK12) (NM_145894) Human Untagged Clone

CAT#: SC125565

KLK12 (untagged)-Human kallikrein-related peptidase 12 (KLK12), transcript variant 2



  "NM_145894" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KLK12 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KLK-L5; KLKL5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_145894, the custom clone sequence may differ by one or more nucleotides


ATGGGGCTCAGCATCTTTTTGCTCCTGTGTGTTCTTGGGCTCAGCCAGGCAGCCACACCGAAGATTTTCA
ATGGCACTGAGTGTGGGCGTAACTCACAGCCGTGGCAGGTGGGGCTGTTTGAGGGCACCAGCCTGCGCTG
CGGGGGTGTCCTTATTGACCACAGGTGGGTCCTCACAGCGGCTCACTGCAGCGGCAGCAGGTACTGGGTG
CGCCTGGGGGAACACAGCCTCAGCCAGCTCGACTGGACCGAGCAGATCCGGCACAGCGGCTTCTCTGTGA
CCCATCCCGGCTACCTGGGAGCCTCGACGAGCCACGAGCACGACCTCCGGCTGCTGCGGCTGCGCCTGCC
CGTCCGCGTAACCAGCAGCGTTCAACCCCTGCCCCTGCCCAATGACTGTGCAACCGCTGGCACCGAGTGC
CACGTCTCAGGCTGGGGCATCACCAACCACCCACGGAACCCATTCCCGGATCTGCTCCAGTGCCTCAACC
TCTCCATCGTCTCCCATGCCACCTGCCATGGTGTGTATCCCGGGAGAATCACGAGCAACATGGTGTGTGC
AGGCGGCGTCCCGGGGCAGGATGCCTGCCAGGGTGATTCTGGGGGCCCCCTGGTGTGTGGGGGAGTCCTT
CAAGGTCTGGTGTCCTGGGGGTCTGTGGGGCCCTGTGGACAAGATGGCATCCCTGGAGTCTACACCTATA
TTTGCAAGTATGTGGACTGGATCCGGATGATCATGAGGAACAACTGA


Restriction Sites Please inquire     
ACCN NM_145894
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145894.1, NP_665901.1
RefSeq Size 1074 bp
RefSeq ORF 747 bp
Locus ID 43849
UniProt ID Q9UKR0
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses alternate splice sites in the 3' coding region, as compared to variant 1. Isoform 2 has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...