AKR1C2 (NM_001354) Human Untagged Clone

CAT#: SC128267

AKR1C2 (untagged)-Human aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2, bile acid binding protein, 3-alpha hydroxysteroid dehydrogenase, type III) (AKR1C2), transcript variant 1



  "NM_001354" in other vectors (6)

CNY 6,270.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-AKR1C2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AKR1C-pseudo; BABP; DD; DD-2; DD/BABP; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8; TDD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001354, the custom clone sequence may differ by one or more nucleotides


ATGGATTCGAAATACCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGATTTGGCACCT
ATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTCTAGAGGCCGTCAAATTGGCAATAGAAGCCGGGTTCCA
CCATATTGATTCTGCACATGTTTACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCA
GATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGAGCAATTCCCATCGACCAGAGT
TGGTCCGACCAGCCTTGGAAAGGTCACTGAAAAATCTTCAATTGGACTATGTTGACCTCTATCTTATTCA
TTTTCCAGTGTCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGAC
ACAGTGGATCTCTGTGCCACATGGGAGGCCATGGAGAAGTGTAAAGATGCAGGATTGGCCAAGTCCATCG
GGGTGTCCAACTTCAACCACAGGCTGCTGGAGATGATCCTCAACAAGCCAGGGCTCAAGTACAAGCCTGT
CTGCAACCAGGTGGAATGTCATCCTTACTTCAACCAGAGAAAACTGCTGGATTTCTGCAAGTCAAAAGAC
ATTGTTCTGGTTGCCTATAGTGCTCTGGGATCCCATCGAGAAGAACCATGGGTGGACCCGAACTCCCCGG
TGCTCTTGGAGGACCCAGTCCTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCT
GCGCTACCAGCTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
GTGCAGGTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAACAGAAATGTGC
GATATTTGACCCTTGATATTTTTGCTGGCCCCCCTAATTATCCATTTTCTGATGAATATTAA


Restriction Sites NotI-NotI     
ACCN NM_001354
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001354.4, NP_001345.1
RefSeq Size 1663 bp
RefSeq ORF 972 bp
Locus ID 1646
UniProt ID P52895
Domains aldo_ket_red
Protein Families Druggable Genome
Protein Pathways Metabolism of xenobiotics by cytochrome P450
Gene Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols using NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme binds bile acid with high affinity, and shows minimal 3-alpha-hydroxysteroid dehydrogenase activity. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...