GNAT1 (NM_000172) Human Untagged Clone
CAT#: SC300019
GNAT1 (untagged)-Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CSNB1G; CSNBAD3; GBT1; GNATR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300019 representing NM_000172.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGGCTGGGGCCAGTGCTGAGGAGAAGCACTCCAGGGAGCTGGAAAAGAAGCTGAAAGAGGACGCT GAGAAGGATGCTCGAACCGTGAAGCTGCTGCTTCTGGGTGCCGGTGAGTCCGGGAAGAGCACCATCGTC AAGCAGATGAAGATTATCCACCAGGACGGGTACTCGCTGGAAGAGTGCCTCGAGTTTATCGCCATCATC TACGGCAACACGTTGCAGTCCATCCTGGCCATCGTACGCGCCATGACCACACTCAACATCCAGTACGGA GACTCTGCACGCCAGGACGACGCCCGGAAGCTGATGCACATGGCAGACACTATCGAGGAGGGCACGATG CCCAAGGAGATGTCGGACATCATCCAGCGGCTGTGGAAGGACTCCGGTATCCAGGCCTGTTTTGAGCGC GCCTCGGAGTACCAGCTCAACGACTCGGCGGGCTACTACCTCTCCGACCTGGAGCGCCTGGTAACCCCG GGCTACGTGCCCACCGAGCAGGACGTGCTGCGCTCGCGAGTCAAGACCACTGGCATCATCGAGACGCAG TTCTCCTTCAAGGATCTCAACTTCCGGATGTTCGATGTGGGCGGGCAGCGCTCGGAGCGCAAGAAGTGG ATCCACTGCTTCGAGGGCGTGACCTGCATCATCTTCATCGCGGCGCTGAGCGCCTACGACATGGTGCTA GTGGAGGACGACGAAGTGAACCGCATGCACGAGAGCCTGCACCTGTTCAACAGCATCTGCAACCACCGC TACTTCGCCACGACGTCCATCGTGCTCTTCCTTAACAAGAAGGACGTCTTCTTCGAGAAGATCAAGAAG GCGCACCTCAGCATCTGTTTCCCGGACTACGATGGACCCAACACCTACGAGGACGCCGGCAACTACATC AAGGTGCAGTTCCTCGAGCTCAACATGCGGCGCGACGTGAAGGAGATCTATTCCCACATGACGTGCGCC ACCGACACGCAGAACGTCAAATTTGTCTTCGACGCTGTCACCGACATCATCATCAAGGAGAACCTCAAA GACTGTGGCCTCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_000172 |
Insert Size | 1053 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000172.3 |
RefSeq Size | 2483 bp |
RefSeq ORF | 1053 bp |
Locus ID | 2779 |
UniProt ID | P11488 |
Protein Families | Druggable Genome |
MW | 40 kDa |
Gene Summary | Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in rods. This gene is also expressed in other cells, and has been implicated in bitter taste transduction in rat taste cells. Mutations in this gene result in autosomal dominant congenital stationary night blindness. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221095 | GNAT1 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2 |
CNY 5,488.00 |
|
RC221095L1 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC221095L2 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC221095L3 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221095L4 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG221095 | GNAT1 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1 (GNAT1), transcript variant 2 |
CNY 7,088.00 |