United States
Germany
Japan
United Kingdom
China
Aquaporin 2 (AQP2) (NM_000486) Human Untagged Clone
CAT＃: SC300078
AQP2 (untagged)-Human aquaporin 2 (collecting duct) (AQP2)
CNY 2,400.00
CNY 6,270.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AQP-CD; NDI2; WCH-CD |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000486 edited
AGGGCTCTGCAGCATGTGGGAGCTCCGCTCCATAGCCTTCTCCAGGGCTGTGTTCGCAGA GTTCCTGGCCACACTCCTCTTCGTCTTCTTTGGCCTCGGCTCTGCCCTCAACTGGCCACA GGCCCTGCCCTCTGTGCTACAGATTGCCATGGCGTTTGGCTTGGGTATTGGCACCCTGGT ACAGGCTCTGGGCCACATAAGCGGGGCCCACATCAACCCTGCCGTGACTGTGGCCTGCCT GGTGGGCTGCCACGTCTCCGTTCTCCGAGCCGCCTTCTACGTGGCTGCCCAGCTGCTGGG GGCTGTGGCCGGAGCCGCTCTGCTCCATGAGATCACGCCAGCAGACATCCGCGGGGACCT GGCTGTCAATGCTCTCAGCAACAGCACGACGGCTGGCCAGGCGGTGACTGTGGAGCTCTT CCTGACACTGCAGCTGGTGCTCTGCATCTTCGCCTCCACCGATGAGCGCCGCGGAGAGAA CCCGGGCACCCCTGCTCTCTCCATAGGCTTCTCTGTGGCCCTGGGCCACCTCCTTGGGAT CCATTACACCGGCTGCTCTATGAATCCTGCCCGCTCCCTGGCTCCAGCTGTCGTCACTGG CAAATTTGATGACCACTGGGTCTTCTGGATCGGACCCCTGGTGGGCGCCATCCTGGGCTC CCTCCTCTACAACTACGTGCTGTTTCCGCCAGCCAAGAGCCTGTCGGAGCGCCTGGCAGT GCTGAAGGGCCTGGAGCCGGACACCGATTGGGAGGAGCGCGAGGTGCGACGGCGGCAGTC GGTGGAGCTGCACTCGCCGCAGAGCCTGCCACGGGGTACCAAGGCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_000486 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000486.3, NP_000477.1 |
| RefSeq Size | 4222 bp |
| RefSeq ORF | 816 bp |
| Locus ID | 359 |
| UniProt ID | P41181 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and recessive forms of nephrogenic diabetes insipidus. [provided by RefSeq, Oct 2008] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Autoantibodies Targeting a Collecting Duct-Specific Water Channel in Tubulointerstitial Nephritis
,Landegren, N;Pourmousa Lindberg, M;Skov, J;Hallgren, Å;Eriksson, D;Lisberg Toft-Bertelsen, T;MacAulay, N;Hagforsen, E;Räisänen-Sokolowski, A;Saha, H;Nilsson, T;Nordmark, G;Ohlsson, S;Gustafsson, J;Husebye, ES;Larsson, E;Anderson, MS;Perheentupa, J;Rorsman, F;Fenton, RA;Kämpe, O;,
J. Am. Soc. Nephrol.
,PubMed ID 26984885
[AQP2]
|
|
Co-regulated pendrin and aquaporin 5 expression and trafficking in type-B intercalated cells under potassium depletion
,Procino, G;Milano, S;Tamma, G;Dossena, S;,
Cell Physiol Biochem Dec 2013.
[AQP2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206553 | AQP2 (Myc-DDK-tagged)-Human aquaporin 2 (collecting duct) (AQP2) |
CNY 2,400.00 |
|
| RC206553L1 | Lenti ORF clone of Human aquaporin 2 (collecting duct) (AQP2), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC206553L2 | Lenti ORF clone of Human aquaporin 2 (collecting duct) (AQP2), mGFP tagged |
CNY 5,890.00 |
|
| RC206553L3 | Lenti ORF clone of Human aquaporin 2 (collecting duct) (AQP2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC206553L4 | Lenti ORF clone of Human aquaporin 2 (collecting duct) (AQP2), mGFP tagged |
CNY 5,890.00 |
|
| RG206553 | AQP2 (tGFP-tagged) - Human aquaporin 2 (collecting duct) (AQP2) |
CNY 4,000.00 |
其它Aquaporin 2产品
