C8 (C8G) (NM_000606) Human Untagged Clone
CAT#: SC300107
C8G (untagged)-Human complement component 8, gamma polypeptide (C8G)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C8C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300107 representing NM_000606.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGCCCCCTGGGACTGCGACCCTCTTGACTCTGCTCCTGGCAGCTGGCTCGCTGGGCCAGAAGCCT CAGAGGCCACGCCGGCCCGCATCCCCCATCAGCACCATCCAGCCCAAGGCCAATTTTGATGCTCAGCAG TTTGCAGGGACCTGGCTCCTTGTGGCTGTGGGCTCCGCTTGCCGTTTCCTGCAGGAGCAGGGCCACCGG GCCGAGGCCACCACACTGCATGTGGCTCCCCAGGGCACAGCCATGGCTGTCAGTACCTTCCGAAAGCTG GATGGGATCTGCTGGCAGGTGCGCCAGCTCTATGGAGACACAGGGGTCCTCGGCCGCTTCCTGCTTCAA GCCCGAGACGCCCGAGGGGCTGTGCACGTGGTTGTCGCTGAGACCGACTACCAGAGTTTCGCTGTCCTG TACCTGGAGCGGGCGGGGCAGCTGTCAGTGAAGCTCTACGCCCGCTCGCTCCCTGTGAGCGACTCGGTC CTGAGTGGGTTTGAGCAGCGGGTCCAGGAGGCCCACCTGACTGAGGACCAGATCTTCTACTTCCCCAAG TACGGCTTCTGCGAGGCTGCAGACCAGTTCCACGTCCTGGACGAAGTGAGGAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_000606 |
Insert Size | 609 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000606.2 |
RefSeq Size | 888 bp |
RefSeq ORF | 609 bp |
Locus ID | 733 |
UniProt ID | P07360 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus |
MW | 22.3 kDa |
Gene Summary | The protein encoded by this gene belongs to the lipocalin family. It is one of the three subunits that constitutes complement component 8 (C8), which is composed of a disulfide-linked C8 alpha-gamma heterodimer and a non-covalently associated C8 beta chain. C8 participates in the formation of the membrane attack complex (MAC) on bacterial cell membranes. While subunits alpha and beta play a role in complement-mediated bacterial killing, the gamma subunit is not required for the bactericidal activity. [provided by RefSeq, Jul 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222236 | C8G (Myc-DDK-tagged)-Human complement component 8, gamma polypeptide (C8G) |
CNY 2,400.00 |
|
RC222236L1 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222236L2 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), mGFP tagged |
CNY 4,800.00 |
|
RC222236L3 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222236L4 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), mGFP tagged |
CNY 5,890.00 |
|
RG222236 | C8G (tGFP-tagged) - Human complement component 8, gamma polypeptide (C8G) |
CNY 4,370.00 |