United States
Germany
Japan
United Kingdom
China
Gastrin (GAST) (NM_000805) Human Untagged Clone
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GAS |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_000805 edited
GGCACCACACACCTCCCAGCTCTGCAGACGAGATGCAGCGACTATGTGTGTATGTGCTGA TCTTTGCACTGGCTCTGGCCGCCTTCTCTGAAGCTTCTTGGAAGCCCCGCTCCCAGCAGC CAGATGCACCCTTAGGTACAGGGGCCAACAGGGACCTGGAGCTACCCTGGCTGGAGCAGC AGGGCCCAGCCTCTCATCATCGAAGGCAGCTGGGACCCCAGGGTCCCCCACACCTCGTGG CAGACCCGTCCAAGAAGCAGGGACCATGGCTGGAGGAAGAAGAAGAAGCCTATGGATGGA TGGACTTCGGCCGCCGCAGTGCTGAGGATGAGAACTAACAATCCTAGAACCAAGCTTCAG AGCCTAGCCACCTCCCACCCCACTCCAGCCCTGTCCCCTGAAAAACTGAT |
| Restriction Sites | Please inquire |
| ACCN | NM_000805 |
| Insert Size | 400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000805.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000805.3, NP_000796.1 |
| RefSeq Size | 440 bp |
| RefSeq ORF | 306 bp |
| Locus ID | 2520 |
| UniProt ID | P01350 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210222 | GAST (Myc-DDK-tagged)-Human gastrin (GAST) |
CNY 1,200.00 |
|
| RC210222L1 | Lenti ORF clone of Human gastrin (GAST), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC210222L2 | Lenti ORF clone of Human gastrin (GAST), mGFP tagged |
CNY 5,890.00 |
|
| RC210222L3 | Lenti ORF clone of Human gastrin (GAST), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC210222L4 | Lenti ORF clone of Human gastrin (GAST), mGFP tagged |
CNY 5,890.00 |
|
| RG210222 | GAST (tGFP-tagged) - Human gastrin (GAST) |
CNY 2,800.00 |
其它Gastrin产品
