United States
Germany
Japan
United Kingdom
China
Oxytocin neurophysin 1 (OXT) (NM_000915) Human Untagged Clone
CAT＃: SC300150
OXT (untagged)-Human oxytocin, prepropeptide (OXT)
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | OT; OT-NPI; OXT-NPI |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_000915 edited
ATGGCCGGCCCCAGCCTCGCTTGCTGTCTGCTCGGCCTCCTGGCGCTGACCTCCGCCTGC TACATCCAGAACTGCCCCCTGGGAGGCAAGAGGGCCGCGCCGGACCTCGACGTGCGCAAG TGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGCTGCTTCGGGCCCAATATCTGCTGCGCG GAAGAGCTGGGCTGCTTCGTGGGCACCGCCGAAGCGCTGCGCTGCCAGGAGGAGAACTAC CTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCGTGCGGGAGCGGGGGCCGCTGCGCGGTC TTGGGCCTCTGCTGCAGCCCGGACGGCTGCCACGCCGACCCTGCCTGCGACGCGGAAGCC ACCTTCTCCCAGCGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_000915 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000915.2, NP_000906.1 |
| RefSeq Size | 512 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 5020 |
| UniProt ID | P01178 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a precursor protein that is processed to produce oxytocin and neurophysin I. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin I. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. [provided by RefSeq, Dec 2013] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224226 | OXT (Myc-DDK-tagged)-Human oxytocin, prepropeptide (OXT) |
CNY 1,200.00 |
|
| RC224226L1 | Lenti ORF clone of Human oxytocin, prepropeptide (OXT), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC224226L2 | Lenti ORF clone of Human oxytocin, prepropeptide (OXT), mGFP tagged |
CNY 5,890.00 |
|
| RC224226L3 | Lenti ORF clone of Human oxytocin, prepropeptide (OXT), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224226L4 | Lenti ORF clone of Human oxytocin, prepropeptide (OXT), mGFP tagged |
CNY 5,890.00 |
|
| RG224226 | OXT (tGFP-tagged) - Human oxytocin, prepropeptide (OXT) |
CNY 2,800.00 |
其它Oxytocin neurophysin 1产品
