LIM domain only 3 (LMO3) (NM_001001395) Human Untagged Clone
CAT#: SC300176
LMO3 (untagged)-Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RBTN3; RBTNL2; Rhom-3; RHOM3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300176 representing NM_001001395.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCTCAGTCCAGCCAGACACCAAGCCGAAAGGTTGTGCTGGCTGCAACCGAAAGATCAAGGACCGG TATCTTCTAAAGGCACTGGACAAATACTGGCATGAAGACTGCCTGAAGTGTGCCTGCTGTGACTGTCGC TTGGGAGAGGTGGGCTCCACCCTGTACACTAAAGCTAATCTTATCCTTTGTCGCAGAGACTATCTGAGG CTCTTTGGTGTAACGGGAAACTGCGCTGCCTGTAGTAAGCTCATCCCTGCCTTTGAGATGGTGATGCGT GCCAAGGACAATGTTTACCACCTGGACTGCTTTGCATGTCAGCTTTGTAATCAGAGATTTTGTGTTGGA GACAAATTTTTCCTAAAGAATAACATGATCCTTTGCCAGACGGACTACGAGGAAGGTTTAATGAAAGAA GGTTATGCACCCCAGGTTCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001395 |
Insert Size | 438 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001395.2 |
RefSeq Size | 3592 bp |
RefSeq ORF | 438 bp |
Locus ID | 55885 |
UniProt ID | Q8TAP4 |
Protein Families | Transcription Factors |
MW | 16.6 kDa |
Gene Summary | The protein encoded by this gene belongs to the rhombotin family of cysteine-rich LIM domain oncogenes. This gene is predominantly expressed in the brain. Related family members, LMO1 and LMO2 on chromosome 11, have been reported to be involved in chromosomal translocations in T-cell leukemia. Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) contains an alternate 5' non-coding exon compared to variant 1. Variants 1-4 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213789 | LMO3 (Myc-DDK-tagged)-Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2 |
CNY 1,200.00 |
|
RC213789L1 | Lenti ORF clone of Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213789L2 | Lenti ORF clone of Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC213789L3 | Lenti ORF clone of Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213789L4 | Lenti ORF clone of Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2, mGFP tagged |
CNY 3,600.00 |
|
RG213789 | LMO3 (tGFP-tagged) - Human LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2 |
CNY 2,800.00 |
其它LIM domain only 3产品