UBE2W (NM_001001481) Human Untagged Clone
CAT#: SC300195
UBE2W (untagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UBC-16; UBC16 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001001481, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCAATGCAGACCACAGGAAGGAGGGTGGAAGTATGGTTTCCAAAACGACTACAG AAAGAACTGTTGGCTTTGCAAAATGACCCACCTCCTGGAATGACCTTAAATGAGAAGAGT GTTCAAAATTCAATTACACAGTGGATTGTAGACATGGAAGGTGCACCAGGTACCTTATAT GAAGGGGAAAAATTTCAACTTCTATTTAAATTTAGTAGTCGATATCCTTTTGACTCTCCT CAGGTCATGTTTACTGGTGAAAATATTCCTGTTCATCCTCATGTTTATAGCAATGGTCAT ATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCAGCGCTCTCAGTCCAATCAGTTTGT CTTAGCATTATTAGCATGCTTTCCAGCTGCAAGGAAAAGAGACGACCACCGGATAATTCT TTTTATGTGCGAACATGTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGATGAT ACTTGTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001001481 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001481.1, NP_001001481.1 |
RefSeq Size | 4057 bp |
RefSeq ORF | 489 bp |
Locus ID | 55284 |
UniProt ID | Q96B02 |
Protein Families | Transcription Factors |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221130 | UBE2W (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1 |
CNY 1,200.00 |
|
RC221130L1 | Lenti-ORF clone of UBE2W (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1 |
CNY 5,890.00 |
|
RC221130L2 | Lenti-ORF clone of UBE2W (mGFP-tagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1 |
CNY 5,890.00 |
|
RC221130L3 | Lenti-ORF clone of UBE2W (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1 |
CNY 5,890.00 |
|
RC221130L4 | Lenti-ORF clone of UBE2W (mGFP-tagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1 |
CNY 5,890.00 |
|
RG221130 | UBE2W (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1 |
CNY 4,370.00 |