Host cell factor C1 regulator 1 (HCFC1R1) (NM_001002018) Human Untagged Clone
CAT#: SC300392
HCFC1R1 (untagged)-Human host cell factor C1 regulator 1 (XPO1 dependent) (HCFC1R1), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HPIP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300392 representing NM_001002018.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATCCTGCAGCAGCCCTTGCAGCGAGGCCCCCAGGGAGGGGCCCAGCGCCTCCCGCGGGCCGCCTTG GGGGTGACTTGGGGCCTGGACGCCAGCTCCCCTCTCCGAGGAGCTGTGCCCATGAGCACCAAGCGGCGC CTGGAGGAGGAGCAGGAGCCTCTGCGCAAGCAGTTTCTGTCTGAGGAGAACATGGCCACCCACTTCTCT CAACTCAGCCTGCACAATGACCACCCCTACTGCAGCCCCCCCATGACCTTCTCCCCAGCCCTGCCCCCA CTCAGGAGCCCTTGCTCTGAGCTGCTTCTCTGGCGCTATCCTGGCAGCCTCATCCCTGAGGCCCTCCGT CTGCTGAGGCTGGGGGACACCCCCAGTCCCCCCTACCCTGCAACCCCAGCTGGGGACATAATGGAGCTC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001002018 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001002018.2 |
RefSeq Size | 811 bp |
RefSeq ORF | 417 bp |
Locus ID | 54985 |
UniProt ID | Q9NWW0 |
Protein Families | Druggable Genome |
MW | 15.3 kDa |
Gene Summary | Regulates HCFC1 activity by modulating its subcellular localization. Overexpression of HCFC1R1 leads to accumulation of HCFC1 in the cytoplasm. HCFC1R1-mediated export may provide the pool of cytoplasmic HCFC1 required for import of virion-derived VP16 into the nucleus.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 3, and 4 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217374 | HCFC1R1 (Myc-DDK-tagged)-Human host cell factor C1 regulator 1 (XPO1 dependent) (HCFC1R1), transcript variant 3 |
CNY 1,200.00 |
|
RC217374L3 | Lenti ORF clone of Human host cell factor C1 regulator 1 (XPO1 dependent) (HCFC1R1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217374L4 | Lenti ORF clone of Human host cell factor C1 regulator 1 (XPO1 dependent) (HCFC1R1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG217374 | HCFC1R1 (tGFP-tagged) - Human host cell factor C1 regulator 1 (XPO1 dependent) (HCFC1R1), transcript variant 3 |
CNY 4,370.00 |
其它Host cell factor C1 regulator 1产品