Host cell factor C1 regulator 1 (HCFC1R1) (NM_001002018) Human Untagged Clone

CAT#: SC300392

HCFC1R1 (untagged)-Human host cell factor C1 regulator 1 (XPO1 dependent) (HCFC1R1), transcript variant 3



  "NM_001002018" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HCFC1R1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300392 representing NM_001002018.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCCTGCAGCAGCCCTTGCAGCGAGGCCCCCAGGGAGGGGCCCAGCGCCTCCCGCGGGCCGCCTTG
GGGGTGACTTGGGGCCTGGACGCCAGCTCCCCTCTCCGAGGAGCTGTGCCCATGAGCACCAAGCGGCGC
CTGGAGGAGGAGCAGGAGCCTCTGCGCAAGCAGTTTCTGTCTGAGGAGAACATGGCCACCCACTTCTCT
CAACTCAGCCTGCACAATGACCACCCCTACTGCAGCCCCCCCATGACCTTCTCCCCAGCCCTGCCCCCA
CTCAGGAGCCCTTGCTCTGAGCTGCTTCTCTGGCGCTATCCTGGCAGCCTCATCCCTGAGGCCCTCCGT
CTGCTGAGGCTGGGGGACACCCCCAGTCCCCCCTACCCTGCAACCCCAGCTGGGGACATAATGGAGCTC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001002018
Insert Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001002018.2
RefSeq Size 811 bp
RefSeq ORF 417 bp
Locus ID 54985
UniProt ID Q9NWW0
Protein Families Druggable Genome
MW 15.3 kDa
Gene Summary Regulates HCFC1 activity by modulating its subcellular localization. Overexpression of HCFC1R1 leads to accumulation of HCFC1 in the cytoplasm. HCFC1R1-mediated export may provide the pool of cytoplasmic HCFC1 required for import of virion-derived VP16 into the nucleus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 3, and 4 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Host cell factor C1 regulator 1产品

Customer Reviews 
Loading...