ZNF280D (NM_001002844) Human Untagged Clone
CAT#: SC300460
ZNF280D (untagged)-Human zinc finger protein 280D (ZNF280D), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SUHW4; ZNF634 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001002844, the custom clone sequence may differ by one or more nucleotides
ATGGGCGACAACCCTTTTCAACCAAAAAGTAATTCAAAAATGGCAGAACTGTTTATGGAA TGTGAAGAAGAGGAGCTGGAACCATGGCAGAAGAAAGTAAAAGAAGTTGAGGATGACGAT GATGATGAGCCAATCTTTGTTGGCGAGATATCAAGTTCAAAACCAGCAATTTCAAATATT TTGAACAGAGTTAACCCCAGCTCATATTCAAGGGGACTAAAGAATGGTGCACTCAGTCGA GGTATTACTGCTGCATTCAAGCCTACAAGTCAACACTACACGAATCCAACATCAAATCCA GTGCCTGCCTCACCAATAAATTTTCATCCTGAGTCTAGATCTTCAGATAGTTCTGTTATT GTTCAGCCTTTTTCTAAACCTGTAAGTGTTTCTAAAACTATACGGCCAGCTCAGGGATCC ATTGGATGTTGTTTATCAATATCAACAGTACCCAGTTACAATTCTGGACTGTCATAA |
Restriction Sites | Please inquire |
ACCN | NM_001002844 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001002844.1, NP_001002844.1 |
RefSeq Size | 2164 bp |
RefSeq ORF | 477 bp |
Locus ID | 54816 |
UniProt ID | Q6N043 |
Gene Summary | May function as a transcription factor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, lacks multiple 3' exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Variants 3 and 5 encode the same protein (isoform 3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223836 | ZNF280D (Myc-DDK-tagged)-Human zinc finger protein 280D (ZNF280D), transcript variant 3 |
CNY 3,990.00 |
|
RC223836L3 | Lenti-ORF clone of ZNF280D (Myc-DDK-tagged)-Human zinc finger protein 280D (ZNF280D), transcript variant 3 |
CNY 5,890.00 |
|
RC223836L4 | Lenti-ORF clone of ZNF280D (mGFP-tagged)-Human zinc finger protein 280D (ZNF280D), transcript variant 3 |
CNY 5,890.00 |
|
RG223836 | ZNF280D (tGFP-tagged) - Human zinc finger protein 280D (ZNF280D), transcript variant 3 |
CNY 4,370.00 |
其它ZNF280D产品