United States
Germany
Japan
United Kingdom
China
Cytochrome b c1 complex subunit 9 (UQCR10) (NM_001003684) Human Untagged Clone
CAT＃: SC300513
UQCR10 (untagged)-Human ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HSPC051; HSPC119; HSPC151; QCR9; UCCR7.2; UCRC |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001003684, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTTCCGCAGGACCTCCACC TTCGCCCTCACCATCATCGTGGGCGTCATGTTCTTCGAGCGCGCCTTCGATCAAGGCGCG GACGCTATCTACGACCACATCAACGAGGGGGTGAGGGCCTGTGCCATCCCTGACCTTGGA CCCGCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001003684 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001003684.1, NP_001003684.1 |
| RefSeq Size | 993 bp |
| RefSeq ORF | 189 bp |
| Locus ID | 29796 |
| UniProt ID | Q9UDW1 |
| Protein Families | Transmembrane |
| Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
| Gene Summary | UCRC is a subunit of mitochondrial complex III (ubiquinol-cytochrome c reductase; EC 1.10.2.2), which forms the middle segment of the respiratory chain of the inner mitochondrial membrane (Schagger et al., 1995 [PubMed 8592474]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant uses an alternate splice site at the 3' end of the first exon compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220688 | UQCR10 (Myc-DDK-tagged)-Human ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
| RC220688L3 | Lenti-ORF clone of UQCR10 (Myc-DDK-tagged)-Human ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RC220688L4 | Lenti-ORF clone of UQCR10 (mGFP-tagged)-Human ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RG220688 | UQCR10 (tGFP-tagged) - Human ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2,920.00 |
其它Cytochrome b c1 complex subunit 9产品
