TARP (NM_001003806) Human Untagged Clone
CAT#: SC300557
TARP (untagged)-Human TCR gamma alternate reading frame protein (TARP), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD3G; TCRG; TCRGC1; TCRGC2; TCRGV |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001003806, the custom clone sequence may differ by one or more nucleotides
ATGAAGACTAACGACACATACATGAAATTTAGCTGGTTAACGGTGCCAGAAAAGTCACTG GACAAAGAACACAGATGTATCGTCAGACATGAGAATAATAAAAACGGAGTTGATCAAGAA ATTATCTTTCCTCCAATAAAGACAGATGTCATCACAATGGATCCCAAAGACAATTGTTCA AAAGATGCAAATGATACACTACTGCTGCAGCTCACAAACACCTCTGCATATTACATGTAC CTCCTCCTGCTCCTCAAGAGTGTGGTCTATTTTGCCATCATCACCTGCTGTCTGCTTAGA AGAACGGCTTTCTGCTGCAATGGAGAGAAATCATAA |
Restriction Sites | Please inquire |
ACCN | NM_001003806 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001003806.1, NP_001003806.1 |
RefSeq Size | 1027 bp |
RefSeq ORF | 336 bp |
Locus ID | 445347 |
Protein Families | Transmembrane |
Gene Summary | In some non-lymphoid tissues, the unrearranged T cell receptor gamma (TRG@) locus is expressed. The resulting transcript contains a subset of the TRG@ gene segments and is shorter than TRG@ transcripts expressed in lymphoid tissues. This RefSeq record represents the unrearranged TRG@ locus transcript; the complete TRG@ locus is represented by the genomic RefSeq NG_001336. The transcript represented by this RefSeq has two open reading frames (ORFs) that encode different proteins. The downstream ORF is in the same frame as TRG@ and its protein product is similar to TRG@ proteins. The upstream ORF uses a different reading frame and encodes a novel protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses the downstream ORF. The resulting protein (isoform 2) is similar to but shorter than TRG@ proteins, since this transcript does not include any variable regions. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217916 | TARP (Myc-DDK-tagged)-Human TCR gamma alternate reading frame protein (TARP), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
RC217916L3 | Lenti-ORF clone of TARP (Myc-DDK-tagged)-Human TCR gamma alternate reading frame protein (TARP), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RC217916L4 | Lenti-ORF clone of TARP (mGFP-tagged)-Human TCR gamma alternate reading frame protein (TARP), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RG217916 | TARP (tGFP-tagged) - Human TCR gamma alternate reading frame protein (TARP), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |