United States
Germany
Japan
United Kingdom
China
BMF (NM_001003940) Human Untagged Clone
CAT＃: SC300580
BMF (untagged)-Human Bcl2 modifying factor (BMF), transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC300580 representing NM_001003940.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCCATCTCAGTGTGTGGAGGAGCTGGAGGATGATGTGTTCCAACCAGAGGATGGGGAGCCGGTG ACCCAACCCGGGAGCTTGCTCTCTGCTGACCTGTTTGCCCAGAGCCTACTGGACTGCCCCCTCAGCCGA CTTCAGCTCTTCCCTCTCACCCACTGCTGTGGCCCTGGCCTTCGACCCACCAGCCAGGAAGACAAAGCT ACCCAGACTCTCAGCCCAGCCTCCCCCAGCCAAGGTGTCATGCTGCCTTGTGGGGTGACTGAGGAACCC CAGCGACTCTTTTATGGCAATGCTGGCTATCGGCTTCCTCTCCCTGCCAGTTTCCCAGCAGTCTTGCCC ATTGGGGAGCAGCCCCCCGAAGGGCAGTGGCAACATCAAGCAGAGGTACAGATTGCCCGAAAGCTTCAG TGCATTGCAGACCAGTTCCACCGGCTTCATGTGCAGCAACACCAGCAGAACCAAAATCGTGTGTGGTGG CAGATCCTCCTCTTCCTGCACAACCTTGCTTTGAATGGAGAAGAGAACAGGAACGGGGCAGGCCCTAGG TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001003940 |
| Insert Size | 555 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. These result in the substitution of 1 aa. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001003940.1 |
| RefSeq Size | 4700 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 90427 |
| UniProt ID | Q96LC9 |
| Protein Families | Druggable Genome |
| MW | 20.5 kDa |
| Gene Summary | The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript. Transcript variants 1 and 2 encode the longest isoform (bmf-1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209733 | BMF (Myc-DDK-tagged)-Human Bcl2 modifying factor (BMF), transcript variant 1 |
CNY 2,400.00 |
|
| RC209733L1 | Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC209733L2 | Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC209733L3 | Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC209733L4 | Lenti ORF clone of Human Bcl2 modifying factor (BMF), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG209733 | BMF (tGFP-tagged) - Human Bcl2 modifying factor (BMF), transcript variant 1 |
CNY 4,000.00 |
