YBEY (NM_001006114) Human Untagged Clone
CAT#: SC301058
YBEY (untagged)-Human ybeY metallopeptidase (putative) (YBEY), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C21orf57 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301058 representing NM_001006114.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTTTGGTGATTAGAAATCTGCAGCGAGTCATCCCCATCAGGAGAGCGCCACTTCGCAGTAAGATC GAGATTGTAAGGAGGATTTTAGGAGTGCAGAAATTTGACCTGGGGATCATCTGTGTTGACAACAAGAAT ATTCAGCACATTAATAGAATCTACAGAGATAGAAATGTCCCAACCGATGTGCTTTCTTTTCCATTTCAT GAGCATCTGAAAGCAGGTGAATTTCCCCAGCCTGATTTTCCAGATGACTACAATTTGGGAGACATTTTC CTAGGAGTGGAGTATATCTTCCATCAGTGTAAAGAAAATGAAGATTACAATGACGTCCTGACTGTAAGC GGGGATGCTGAAATCATATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001006114 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001006114.2 |
RefSeq Size | 1528 bp |
RefSeq ORF | 366 bp |
Locus ID | 54059 |
MW | 14.1 kDa |
Gene Summary | This gene encodes a highly conserved metalloprotein. A similar protein in bacteria acts as an endoribonuclease, and is thought to function in ribosomal RNA maturation and ribosome assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) differs in the 5' UTR, lacks two 3' exons, and its 3' terminal exon extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Variants 2 and 7 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206879 | YBEY (Myc-DDK-tagged)-Human ybeY metallopeptidase (putative) (YBEY), transcript variant 2 |
CNY 1,200.00 |
|
RC206879L3 | Lenti ORF clone of Human ybeY metallopeptidase (putative) (YBEY), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206879L4 | Lenti ORF clone of Human ybeY metallopeptidase (putative) (YBEY), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG206879 | YBEY (tGFP-tagged) - Human ybeY metallopeptidase (putative) (YBEY), transcript variant 2 |
CNY 4,370.00 |